5.6 qPCR

Q-PCR after RT

Housekeeping gene:

Gene At5g25760 (Ubiquitin Congugating enzyme 21) UBC21

Forward primer TCTCTCTCTCTCTCTCTCGCTCTC Reverse Primer TGATGCCTGCATCTCTAATTTCCC

Re-think the need to have exactly the same amount of RNA in each cDNA reaction.

Set up reactions in ISB. Use Qiagen 204054

Load reactions and take to Sam's lab.

Eppendorf Realplex2 Master Cycler

Reaction set up

component µL/rxn aliquot for 16 rxns
2x quantifast SYBR Green PCR master mix 10 176
qPCR forward primer 10 µM 1 32
qPCR reverse primer 10 µM 1 32
Template cDNA 1 -
RNAse free water 7 (use H2O from RT)
------------------------------------------------ ---- -----
Total 20

qPCR Settings

File - New Assay

plate layout:

Filter: SYBR

Sample volume: 20

Probe: SYBR

Filter: N/A

Background: spec background

Highlight the wells you want to detect. Label as unknowns.

PCR Program:

Step Temp Time
PCR initial heat activation 95 2 min
Denaturation 95 15 sec
Primer annealing 55 15 sec
Extension 68 20 sec

Save the assay.

Press run (green arrow icon).

Plates: USA Scientific 1402-9500

Sealing film: 2921-0010

AttachmentSize
qpcr-primer-labels-2013.doc82.5 KB
qpcr2013.docx67.18 KB
ct_values_from_qpcr_experiments-gg_2014tuth.docx29.58 KB
gg_mw_qpcr-1.xls31 KB
2015_tuth_qpcr_results.xlsx25.04 KB
gga_mw_s2015qpcr.xlsx14.14 KB
sandra_ubi_1_12_nov30_2015.xls30 KB