PCR 2024
PCR 2024 kdorfman Wed, 09/11/2024 - 22:17Reagents
100 uL reaction; 1 reaction per student
| reagent | uL per rxn | uL aliquot for group of 3 to share |
|---|---|---|
| DNA template1 | 1 uL | students use their own miniprep product |
| 10 mM dNTPs | 2 | 10 |
| 5X Phusion buffer2 | 20 | 65 |
| Primers3 20 mM | 5 | 20 |
| water (sterile) | 66.5 | 250 |
| Phusion Enzyme4 | 0.5 | dispensed by instructor with a 2uL pipette |
The PCR program5 is:
- 2 minutes at 95C
- 30 seconds at 95C (Denaturation)
- 30 seconds at 55C (Primer annealing)
- 30 seconds at 72C (Extension)6
- Repeat steps 2-4 30X
- 10 minutes at 72C
- Forever at 4C
-
Amount of DNA template may depend on final concentration of template DNA. If more than 1 ul of DNA needs to be used, reduce the amount of water in the reaction accordingly. Check concentrations with Nano-drop just to see that they got plasmid. ↩︎
-
Use "HF Buffer" unless you have a difficult GC-rich template DNA. Then, you could change to the included "GC" Buffer. ↩︎
-
KLP61 RNAi F: TAATACGACTCACTATAGGGTATTTGCGCATTATTTTAAAA
KLP61 RNAi R: TAATACGACTCACTATAGGGATATTGATCAATTGAAAC
stock is 500 mM ↩︎ -
Fisher F530S Phusion High–Fidelity DNA Polymerase; Switch to NEB M0530L ↩︎
-
on Thermocycler 1, Folder G&GA, program G_GA2022 ↩︎
-
Extension time rule of thumb for Phusion: 15-30 seconds per KB;
Our product will be 500 bp, so we set extension to 30 sec ↩︎