3.2 Planting Salk seeds
3.2 Planting Salk seeds margaret Wed, 11/16/2011 - 18:303.1 Identifying T-DNA insertion sites 2/28/13
ORDER PRIMERS
Need homozygous strains for low iron testing. Indicated by Salk ________c
K Dorfman SALK-LB195
TCGGAACCACCATCAAACGGATT
K Dorfman SALK-LB205
CATCAAACAGGATTTTCGCCTGCT
LBb1.3 ATTTTGCCGATTTCGGAAC 110 bp from left border http://signal.salk.edu/tdnaprimers.2.html
3.2 Salk line genetics 3/4/13
Plant seeds of SALK lines and prepare to analyze the plants that will grow from them.
Prepare pots for students. 4 pots of soil per pair (plus extras), already treated with Gnatrol by Teddi
Imbibe seeds for students.
Per pair:
- Half of their Salk line seeds (12 if possible)
The other half will be sterilized and planted on agar plates in Lab 3.3 Equivalent number of Col 0 control seeds
(one tube imbibed, one tube dry, just like the Salk seeds)
use #6 from the Col0 rack in room 366APut in water in microfuge tube
wrap each day's worth of seeds separately in foil - if they get any light, their radicles may start to emerge, and they become quite fragile)
store in refrigerator by Friday afternoon for Monday lab