Sequencing

Primers for the 5'

  • Splac2 25mer GAATTCACTGGCCGTCGTTTTACAA

  • Sp1 22mer ACACAACCTTTCCTCTCAACAA

Primers for the 3'

  • Spep1 19mer GACACTCAGAATACTATTC

  • Sp6 23mer TGACCACATCCAAACATCCTCTT

Melting Temps for sequencing primers

  • Splac2 60.1C

  • Sp1 50.6C

  • Sp6 54.9C

  • Spep1 44.8C