2023-Fall
2023-Fall kdorfman Mon, 07/17/2023 - 19:45John Willoughby & Jedi Chilufya
Week | date | Yeast | Fast Plants | Dog |
---|---|---|---|---|
1 | 9/4 | NO LABS | ||
2 | 9/11 | Yeast 1 observe & mate | ||
3 | 9/18 | Yeast 2 replica plate | plant genetics 1; plant seeds | |
4 | 9/25 | micropipetting; Yeast 3 DNA extraction, txfer to YED, then to YEKAc |
F1 observations | |
5 | 10/2 | Yeast 4 (contig assembly ADE1, ADE2 sequences); UV mutagenesis, | pollination | |
6 | 10/9 | NO LABS | collect dog DNA | |
7 | 10/16 | Yeast 5 hunt for mutants, Yeast practical exam | observe F2 | |
8 | 10/23 | observe F2 | Dog DNA extraction | |
9 | 10/30 | collect & plant F2 seeds | Dog DNA quantification, PCR, Molecular basis of dog coat color | |
10 | 11/6 | observe F2 who's the father? | Prep MC1R sample for sequencing, gel electrophoresis | |
11 | 11/13 | work on reports | dog TRYP1 locus, analysis of MC1R genotype & sequence, cap3 sequence assembly | |
12 | 11/20 | THANKSGIVING | ||
13 | 11/27 | bioinformatics | ||
14 | 12/4 | Dog genotype/phenotype presentations | ||
(15) | 12/11 | finals week | report due |
Dog Genetics Labs 2023-F
Dog Genetics Labs 2023-F kdorfman Thu, 07/20/2023 - 18:08Here are the prep pages for the dog genetics labs 2023
Puritan Try Cap-shure Swabs with attached caps from McKesson
Dog Cell Lines
Dog Cell Lines kdorfman Fri, 09/01/2023 - 15:06Line # | breed | defrost | frozen? | # swabs | notes |
---|---|---|---|---|---|
104 | Newfoundland (M) | 8/28 | Very few adherent cells as of 9/1 | ||
104 | Newfoundland (M) | 8/31 | 10 4 from spun down culture medium |
huge numbers of floating cells (made swabs from liquid) | |
105 | golden | 8/28 | 6 from spun down culture medium | very few cells overall, adherents are round | |
106 | Maltese | 8/28 | 8/30 | 15 3 10/23/23 |
huge numbers of cells. put into 2 25 cm2 flasks>. tested regular DMEM in 12.5 cm2 flask. 1 25 cm2 flask to freeze |
109 | terrier mix? | 8/28 | about 2 adherent cells per field of view at 10x | ||
110 | pointer | 8/28 | single digits adherent cells | ||
IPC 366 1 | ? | 8/28 | 9/1 | 9 | grew like gangbusters! 3 swabs per 12.5 cm2 flask. froze one thawed and grew up for swabs. Buckets of DNA!! (multinucleate). Froze 2 more vials. |
112 | Yorkshire terrier 11 YO F | 9/8/23 | 6 15 from trypsinized T75 flask |
Grow great! thawed and grew, made swabs, then they petered out. Not able to amplify enough to freeze another vial. |
|
113 | Beagle (Thelma) 6YO F | 9/12/23 | 10 from trypsinized T75 flask | great growing cell line, but started to fail after split. Maybe seeded too thinly? Split them all to a smaller flask 9/27 to see if they will grow up to large enough numbers to freeze |
Link to Kathleen's photo gallery
Dog DNA summary
Dog DNA summary kdorfman Wed, 08/02/2023 - 14:47Genes
letter | gene | full name | traits |
---|---|---|---|
E | MC1R | melanocortin 1 receptor | eumelanin (requires signal molecule from agouti or defb) vs. pheomelanin ee produces a non-functioning MC1R |
K | defb103 | defensin beta 103 (= CBD103 beta-defensin 103) | dominant black has a glycine deletion KB makes a signal that binds tightly to MC1R, preventing agouti expression |
B | TyRP1 | tyrosinase related protein 1 | black (B_) vs brown (bb) |
A | ASIP | Agouti Signaling Protein | ASIP promotes pheomelanin (aa: no signal, A_ signal with varying on-off patterns) |
MC1R Alleles
letter | gene | full name | traits |
---|---|---|---|
E | |||
ee |
Agouti Alleles
letter | gene | full name | traits |
---|---|---|---|
Ay | |||
Aw | |||
aa |
NOTE: If you have the nucleotide sequence for an individual and the reference amino acid sequence, to compare them:
Blastx
Query: nucleotide sequence
Subject: reference amino acid sequence
Agouti sequences
Agouti sequences kdorfman Mon, 08/21/2023 - 14:08ASIP
To find the crucial 82, 83, 96 amino acids:
_ _ PRPP...CVAT _
82 83 ................. 96
MC1R sequences
MC1R sequences kdorfman Mon, 08/21/2023 - 14:10MC1R
TYRP sequences
TYRP sequences kdorfman Mon, 08/21/2023 - 14:09TyRP
defB103
defB103 kdorfman Mon, 08/21/2023 - 14:10defB
Week 07 DNA collection
Week 07 DNA collection kdorfman Mon, 07/24/2023 - 21:00Dog DNA labs week of 10/16/23
Instructions for swabbing dog's mouth
Tell students "Go home and swab your dog"
Week 08 DNA extraction
Week 08 DNA extraction kdorfman Mon, 07/24/2023 - 20:25Dog DNA labs, week of 10/23/23
Isolate DNA
1 sample per pair, from:
- Dog cell cultures from Kathleen
- Student dog mouth swabs
- DNA from Cornell BioBank
- Staff dog mouth swabs
QIAamp DNA minikit 51306
Equipment
- Microfuge tubes
- Sterile forceps (to pull swab from extraction buffer)
- QIAamp columns
- collection tubes
- 56C heat block (10 min)
- vortex mixers
- centrifuge 6000 x g 1 min, 20K x g 3 min
- Nanodrop (may need next class, also) (Need to calculate uL to get 100 ng)
Reagents (per swab)
- PBS (400 UL)
- Proteinase K (20 uL)
- Buffer AL (400 uL)
- 95% EtOH (400 uL)
- QIAamp Mini spin column (1)
- 2 mL collection tube (2?)
- Buffer AW1 (500 uL)
- Buffer AW2 (500 uL)
- Buffer AE (50 uL)
Staff makes spreadsheet on Google Drive with:
- sample # for each dog
- concentration
- quality
DNA from cultured cells
DNA from cultured cells kdorfman Tue, 08/22/2023 - 16:04From QIAamp DNA Mini & Blood Mini Handbook, Apendix B, p 50
Do not use more than 5 x 10^6 cells
Important points before starting
- Do not use more than 5 x 106 cells (with a normal set of chromosomes).
- All centrifugation steps are carried out at room temperature (15–25°C).
- Use carrier DNA if the sample contains <10,000 genome equivalents (see page 17).
Things to do before starting
- Heat a water bath or heating block to 56°C.
- Equilibrate Buffer AE or distilled water to room temperature (15–25°C) for elution.
- Ensure that Buffer AW1, Buffer AW2, and QIAGEN Protease have been prepared according to the instructions on page 16.
- If a precipitate has formed in Buffer AL, dissolve by incubating at 56°C.
Procedure
- Harvest cells
- Trypsinize and count cells
- Put no more than 5 million cells into a microfuge tube
- Centrifuge for 5 min at 300 x g.
- Remove the supernatant completely and discard, taking care not to disturb the cell pellet.
- Resuspend cell pellet in PBS to a final volume of 200μL.
- Add 20 μL QIAGEN Protease or proteinase K.
- (Continue with step 3 of “Protocol: DNA Purification from Blood or Body Fluids (Spin Protocol)”, page 27)
Week 09 PCR MC1R
Week 09 PCR MC1R kdorfman Mon, 07/24/2023 - 20:25Dog DNA labs, week of 10/30
students set up 2 identical rxns for MC1R per pair
plus 1 tube each for ASIP, Def103, TyRP1
Equipment
- Nanodrop (for students who didn't finish last week)
- Thermocycler (program: ???)
Reagents
Instructors make MasterMix + primers; students add 100 ng DNA plus water to make ?? uL
- Qiagen MasterMix
- forward primer
- reverse primer
- sterile water
Paper activities
- Complete genetics of dog hair packet
- Complete MC1R activity
- Protein/structure/function activity
Week 10 Exo-SAPiT
Week 10 Exo-SAPiT kdorfman Mon, 07/24/2023 - 20:27Dog DNA labs, week of 11/6
Practice gels to learn well loading
Gel 12 wells MC1R whole class on one gel (100 bp ladder)
ExoSAPIT M1CR 3 tubes/pair
Ready MC1R for sequencing (Ma, Mb, Mc). * 3 tubes per pair (long gene - need to get contigs)
Need Nanodrop again to check concentration
Week 11 Restriction digest
Week 11 Restriction digest kdorfman Mon, 07/24/2023 - 20:27Dog DNA labs, week of 11/13
Genotyping loci B (TyRP1), E (MC1R), K(defb103)
We provide folder with sequences
Restriction digest TyRP1 ("B" locus) 1 uL/rxn each:
We provide uncut
Bioinformatics
- 4peaks to clean sequences Ma, Mb, Mc
- CAP3 to assemble contigs to get MC1R sequence
- Clustal also!
- BLAST to compare to known nt sequences: MC1R (E), Defb103 (K)
- Expasy (nucleotide to amino acid sequence)
- Clustal omega to align aa to known sequences
Week 12 - no labs
Week 12 - no labs kdorfman Wed, 08/09/2023 - 19:56Thanksgiving week of 11/20/23
Week 13
Week 13 kdorfman Mon, 07/24/2023 - 20:27Dog DNA labs, week of 11/27
Analyze data for A (agouti) locus
- Expasy to translate sequence to aa
- CLUSTAL to align aa sequence
- what aa sequence do you have
- is it heterozygous?
- 4Peaks, look for and explain discrepancies
- Make final hair color predictions
Week 14
Week 14 kdorfman Mon, 07/24/2023 - 20:29Dog genotype & phenotype presentations, week of 12/4/23 (last week of classes)
Individual completion of dog Practical
Fast Plants Labs 2023-F
Fast Plants Labs 2023-F kdorfman Thu, 07/20/2023 - 18:08Here are the prep pages for the Fast Plants genetics labs 2023
Fast Plant Resources
Fast Plant Resources kdorfman Thu, 07/20/2023 - 22:00Here are some resources for growing and working with Fast Plants
Purple stem/yellow green leaf stock document
Fast Plants Growing Instructions from Carolina
Fast Plants Life cycle
Fast Plants Life cycle kdorfman Thu, 07/20/2023 - 19:14Interactive life cycle illustration
Day | developmental event(s) |
---|---|
1&2 | germination; seed swells with water until its coat cracks |
3 | hypocotyl pushes through soil, pulling cotyledons with it; seed coat falls off |
4 | hypototyl elongates above soil; roots grow down and anchor plant |
5-8 | True leaves develop; root hairs grow |
9-13 | Flower buds |
14-17 | Flowers open; pollination is possible |
18-20 | Fertilized eggs inside pistils grow to become embryos; pistil swells to become pod |
12-40 | Petals wilt and fall off; pods dry out. (Stop watering to encourage pod maturation.) When they are completely dry, seeds can be harvested |
Fast Plant overall crossing scheme
Fast Plant overall crossing scheme kdorfman Wed, 08/02/2023 - 16:00allele | trait |
---|---|
ANL | purple stem |
anl | green stem (anthocyanin-less) |
YGR | green leaves |
ygr | yellow-green leaves |
Generation | genotype | X | genotype | notes |
---|---|---|---|---|
P | anl/anl (anthocyaninless) | X | ygr/ygr (yellow-green leaf) | we plant demos |
F1 | ANL/anl YGR/ygr | X | ANL/anl YGR/ygr | purchased from Carolina |
F2 | 9 ANL/__ YGR/__: 3 ANL/___ /ygrygy : 3 anl/anl YGR/___ : 1 anl/anl ygr/ygr |
grown up from our F1 x F1 pollination |
Week 03 Planting Fast Plants
Week 03 Planting Fast Plants kdorfman Thu, 07/20/2023 - 18:14Fast Plants Day 1 (week of 9/18/23):
(See also Yeast genetics 2)
Students plant seeds of F1 Non-Purple Stem, Yellow-Green Leaf (anl/ANL, ygr/YGR)
These are the offspring of two P1 strains:
Non-Purple Stem, Hairless (anl/anl) X
Yellow-Green Leaf (ygr,ygr)
We plant at least 6 pots of non-purple stem parents (P1: anl/anl) for a demo, and ask students to puzzle out the genetics of the other parent "Who's the parent?" One pot per table.
- 1 pot per student
- place an inner "mesh" tray into the sink
- place bucket of soil and an empty tray with mesh insert on cart next to sink
place a filled bucket of water by the sink
per pair:
- 15 mL tube of fertilizer pellets (fill tube to ~2ml)
- microfuge tube of F1 seeds (up to 10 seeds/pair)
- little paint brush
- weigh boat
- labeling tape and marker
According to Carolina,
"F1 generation seed will express dominant traits (purple stems, dark green leaves, standard height) and can be used to produce F2 seed that will show the typical monohybrid (3:1) or dihybrid (9:3:3:1) phenotypic ratios. F2 seed will express the appropriate phenotypic ratios."
Rose pots 4x9 in a flat, Instructions to students:
- Use tape to label pots (Section #, Student Pair #, Date, Name)
- Fill 1/3 with potting soil (contain activity inside soil bucket)
- add 8 fertilizer pellets, do not mix
- fill to the top with soil (work inside soil bucket, do not mix)
- push down soil
- put pot in mesh tray in sink, hold down
- add water from a cup to settle the soil
- put up to 5 seeds on soil surface (hoping for min 1 plant/pot)
- cover with dusting of soil
- put in new tray that contains a mesh insert
Instruction to TAs:
- keep (or place) mesh tray of all collected pots in the sink
- water gently, carefully ensuring seeds remain at the top surface of the soil
- ensure soil is packed and moist enough for seeds to germinate
- when different seed genotypes are used, take care not to transfer any seeds between pots
- after excess drains into sink, move into a tray and cover with clear dome lid
- carry tray to growth chamber
Grow in growth chamber in ISB373: 24 hour light, 24C
Water from the bottom (into the tray, not into the pots), as needed
Week 04 F1 Seedling observations
Week 04 F1 Seedling observations kdorfman Mon, 07/24/2023 - 16:34Fast Plants Labs week of 9/23/23
(See also micropipetting and yeast DNA extraction)
See the stock document about observations
Transfer inner slotted tray to a dry flat before transport to classroom
All plants should all be purple stem, green leaves
Make a prediction about P2
Moodle doc "Fast Plants Observations After One Week" has questions for students while they look at plants.
Week 05 Pollination
Week 05 Pollination kdorfman Mon, 07/24/2023 - 16:46Fast Plant Labs week of 10/2/23
See also
F1 x F1 pollination
Remove the rare non-purples before class!
(Not the parents we planted!)
Everyone pollinates every plant. (Staff repeats afterward for complete mixing of pollen)
Non-sterile cotton swab.
Week 06 - no labs
Week 06 - no labs kdorfman Wed, 08/09/2023 - 19:50No Labs - indigenous peoples day
Lab makeups as needed
Week 07 & 08 Plant observations
Week 07 & 08 Plant observations kdorfman Mon, 07/24/2023 - 16:46Fast Plant Labs weeks of 10/16 and 10/23 2023
(See also Yeast DNA sequencing, )
Observe F2 seedlings
Enter F2 data by pair
Week 09 Collect & Plant F2 Seeds
Week 09 Collect & Plant F2 Seeds kdorfman Mon, 07/24/2023 - 16:47Week 10 F2 observations
Week 10 F2 observations kdorfman Mon, 07/24/2023 - 16:55Week 11 - work on reports
Week 11 - work on reports kdorfman Mon, 07/24/2023 - 16:56Fast Plant labs week of 11/13/23
(See also dog TRYP1 locus, analysis of MC1R genotype & sequence, cap3 sequence assembly)
Compile & analyze data
Week 12 - no labs
Week 12 - no labs kdorfman Wed, 08/09/2023 - 19:5111/20 - week of Thanksgiving
Week 13 Plant reports due
Week 13 Plant reports due kdorfman Mon, 07/24/2023 - 16:57Turn in Fast Plants report week of 11/27/23
Turn in report on Fast Plant genetics experiment
See also Dog genes bioinformatics
Yeast Labs 2023-F
Yeast Labs 2023-F kdorfman Thu, 07/20/2023 - 18:07Here are all the prep pages for the yeast genetics labs 2023
A Classroom Guide to Yeast Experiments
Available for purchase from Carolina. (We have a copy available in a 3-ring binder.)
Week 01 - no labs
Week 01 - no labs kdorfman Wed, 08/09/2023 - 19:38No labs on weeks with a holiday
If necessary, amplify the yeast strains students will need for Yeast 1 on YEPAD. Grow up from frozen if necessary.
- HA0 (demo only)
- HA1
- HA2
- HAR
- HB0 (demo only)
- HB1
- HB2
Plate all strains on YED demo plates (all 4 A on one plate, all 4 B on the other), 1 each per table.
Plate strains students will mate (1,2,R) on YEPAD plates, 1 each per pair, (all 3 A on one plate, all 3 B on the other)
Week 02 - Yeast mating
Week 02 - Yeast mating kdorfman Thu, 07/20/2023 - 18:16Yeast labs, week of 9/11/23 (2nd week of classes, 1st complete week)
See notes here
Total YED plates for the week for 4 sections plus prep: 75
Students mate 3 A mating types with 3 alpha mating types
Take YED plates out early so they stop sweating.
Make an assembly line of 7 stations (use templates):
station | activity | materials |
---|---|---|
1 | label plate | YED plates, labeling template, Fisher Finest marker |
2 | plate HA1 across | 3 small plates of HA1 on YEPAD, sterile toothpicks, used toothpick bucket |
3 | plate HA2 across | 3 small plates of HA2 on YEPAD, sterile toothpicks, used toothpick bucket |
4 | plate HAR across | 3 small plates of HAR on YEPAD, sterile toothpicks, used toothpick bucket |
5 | Plate HB1 down, mixing carefully with the A strain already there, new toothpick each time | 3 small plates of HB1 on YEPAD, sterile toothpicks, used toothpick bucket |
6 | Plate HB2 down | 3 small plates of HB2 on YEPAD, sterile toothpicks, used toothpick bucket |
7 | Plate HBR down | 3 small plates of HBR on YEPAD, sterile toothpicks, used toothpick bucket |
For mating, students need these strains on YEPAD plates so they all start out white:
- HA1
- HB1
- HA2
- HB2
- HAR
- HBR
For observation, students need these strains on YED plates so their colors can be observed:
- HA0
- HB0
- HA1
- HB1
- HA2
- HB2
- HAR
- HBR
For observation of colors, make demo plates (maybe 4 of each):
- 4 YED plate with 4 A strains
- 4 YED plate with 4 alpha (B) strains
(If you let the parental strains sit on YED more than a couple of days, the mutant strains turn red, and the red color will still be there even after there are heterozygous diploids with complementation.)
A types | alpha (B) types |
---|---|
HA0 (WT) | HB0 (WT) |
HA1 (ade1) | HB1 (ade1) |
HA2 (ade2) | HB2 (ade2) |
Start 6 strains at least the Friday before the first lab.
Instructors should make some mating plates to have in the fridge to hand out when student plates are bad.
Week 03
Week 03 kdorfman Mon, 07/24/2023 - 20:49Yeast Labs, week of 9/18/23
(See also planting seeds)
Examine mating mixtures
Take picture for notebook
Record colors in notebook
Replicate YED mating plate onto 1 MV plate per pair
- sterile velvets
- replicating plate stampers
- elastic hair ties
- bleach bucket for used velvets
Sample mating yeast for schmoos and diploids; take picture for notebook. Set up mating mixtures in liquid YEPAD 2 hours before class.
48 MV plates
Week 04
Week 04 kdorfman Mon, 07/24/2023 - 20:50Yeast Labs week of 9/25/23
(See also seedling observations)
Pipetting exercises:
- Colorimetric pipetting exercise
- Weighing water
- 1 balance per pair
- weigh boat
- beaker of dH2O
- extra batteries
DNA extraction from yeast
- Reagents
- 200 mM LiOAc, 1% SDS (4x 100 uL/pair)
- 95% EtOH (4 X 300 uL/pair)
- 70% EtOH ( 4 X 400 uL/pair)
- TE ( 4 x 80 uL/pair)
- Equipment
- microfuge tubes
- hot block at 70C
- centrifuges for 1.5 mL tubes, 15,000 x g
- paper towels
- Nanodrop
Sequences
- send out for sequencing?
- 4 strains per table
- really? or pull sequences out of her back pocket?
Check MV replica plate from last week
- check diploids
- draw picture
- label
- transfer
- some??? to YED (to check the next day, next day toothpick to YEKAc plate 1/pair (=48)
- pick one to YED (class "pre-spore")
YED ?2 per pair? = 48
YEKAc??
Week 05
Week 05 kdorfman Mon, 07/24/2023 - 20:50Yeast Lab week of 10/2/23
(See also pollination)
YED plates: 4/pair
Mutagenesis
See notes here
- Sterile technique
- Spray 70% ethanol
- Serial dilution (5 tubes)
- Sterile water
- glass beads
- Wild type stock plate (HA0 or HB0) (1/table)
- YED plates 3/pair
- control (most dilute)
- 7 sec UV exposure (next most dilute)
- 10 sec UV exposure (next most dilute)
- UV transilluminators
- face shields
Come in next day and move plates to fridge
Look for spores
- check YeKAc plate from previous lab; make a wet mount and look for spores
- Microscopes
- slides
- coverslips
- water
- pick from YeKAc plate to YED plate (1/pair) to observe for color next lab
Observe class "pre-spore" YED plate from previous week
ADE sequences
ADE sequences kdorfman Fri, 08/25/2023 - 16:39Week 06 - no labs
Week 06 - no labs kdorfman Wed, 08/09/2023 - 19:39No Labs week of 10/9/23
Indigenous peoples day
Make up labs if needed
Week 07
Week 07 kdorfman Mon, 07/24/2023 - 20:50Yeast Labs week of 10/16/23
See also Observing F2
Count colonies on UV irradiated plates
Check color on YED plate from YeKAc plate
Week 08
Week 08 kdorfman Wed, 08/09/2023 - 19:37Yeast labs, week of 10/23/23
Yeast genetics sequencing recap;
(See also F2 observations and dog DNA extraction))
Yeast genetics practical exam
Yeast ADE primers & pcr
Yeast ADE primers & pcr kdorfman Mon, 08/21/2023 - 14:06Yeast Primers (Carolina stocks)
Gene | primers 1 | product size (bp) |
---|---|---|
Ade 1 | 5’ – GTTGGGTTTTATCTTTTGCAGTTGG - Ade1f JW1b | |
5’ – GGCGACTTGTAGTATATGTAAATCACG -Ade1r | 1040 | |
Ade 2 2 | 5’ - ATTCTCCTGCCAAACAAATAAGCAACTC - Ade2 F25 | |
5’ – ACATTCCGCCATACTGGAGGCAATAA - Ade2 R26 | 1010 | |
Ade 2 | 5’ - TTGCCAATGCCAAAGAATTTCACATC - Ade2 F29 | |
5’ - GCATTGAGCCGCCTTATATGAACTGT - Ade2 R30 | 1085 |
Master Mix
Reagent | uL |
---|---|
2x buffer (4) | 20 |
water | 12.8 |
NEB Taq | 0.2 |
Reaction Mix
Reagent | uL |
---|---|
master mix | 33 |
F primer | 2 |
R primer | 2 |
DNA | uL to get 50 ng |
(water | uL to get to 40 uL) |
Buffer 4 3 1X, pH 8.4
reagent | concentration |
---|---|
Tris-HCl | 14 mM |
KCl | 70 mM (standard taz buffer is 50 mM KCl) |
MgCl2 | 3 mM |
dNTP | 65 uM each |
Program Y-TD1 (anneal 61C -> 57C then 57C)
step | temp | time |
---|---|---|
1 | 94 | 30 s |
2 | 93 | 15 s |
3 | 61 | 20 s (-1C/cycle) |
4 | go to #2 4 times | |
5 | 93 | 15 s |
6 | 57 | 20 s |
7 | 72 | 12 s |
8 | go to #6 29 times | |
9 | 72 | 5 min |
10 | 10 | hold |
-
the forward primers of each gene just miss the ATG start because of the lack of G & C bases outside the cds. ↩︎
-
the 1.7 k.b. Ade2 cds was broken up into two PCR reactions overlapping by 300 bases because of its size and uncertainty over the average size of strands in our crude yeast gDNA prep, but the PCRs seemed to work well with 50 ng, and it might be possible to do the Ade2 in one PCR. ↩︎
-
This is exactly the same as 1x standard taq buffer, but the [KCl] is slightly elevated to help the GC-poor primers anneal. I have just added KCl to the regular reaction before with no problem. (John Willoughby) ↩︎
Yeast primers Dharmacon
Yeast primers Dharmacon kdorfman Thu, 09/07/2023 - 17:01Recommended primers for Dharmacon yeast stocks
gene | notation | up | down |
---|---|---|---|
ADE1 | Dhar HA1 | AGAGATCAGCCAGACTCGTC | |
ADE2 | Dhar HB2 | CCTTCATTGACACTGATCTG | GAGACCAGAACACTTGCCTA |