3.2 Planting Salk seeds

3.1 Identifying T-DNA insertion sites 2/28/13

ORDER PRIMERS

Need homozygous strains for low iron testing. Indicated by Salk ________c

K Dorfman SALK-LB195
TCGGAACCACCATCAAACGGATT

K Dorfman SALK-LB205
CATCAAACAGGATTTTCGCCTGCT

LBb1.3 ATTTTGCCGATTTCGGAAC 110 bp from left border http://signal.salk.edu/tdnaprimers.2.html

3.2 Salk line genetics 3/4/13

Plant seeds of SALK lines and prepare to analyze the plants that will grow from them.

Prepare pots for students. 4 pots of soil per pair (plus extras), already treated with Gnatrol by Teddi

Imbibe seeds for students.
Per pair:

• Half of their Salk line seeds (12 if possible)
  The other half will be sterilized and planted on agar plates in Lab 3.3

• Equivalent number of Col 0 control seeds
  (one tube imbibed, one tube dry, just like the Salk seeds)
  use #6 from the Col0 rack in room 366A

• Put in water in microfuge tube
  wrap each day's worth of seeds separately in foil - if they get any light, their radicles may start to emerge, and they become quite fragile)
  store in refrigerator by Friday afternoon for Monday lab