Q-PCR after RT
Housekeeping gene:
Gene At5g25760 (Ubiquitin Congugating enzyme 21) UBC21
Forward primer TCTCTCTCTCTCTCTCTCGCTCTC Reverse Primer TGATGCCTGCATCTCTAATTTCCC
Re-think the need to have exactly the same amount of RNA in each cDNA reaction.
Set up reactions in ISB. Use Qiagen 204054
Load reactions and take to Sam's lab.
Eppendorf Realplex2 Master Cycler
Reaction set up
component | µL/rxn | aliquot for 16 rxns |
---|---|---|
2x quantifast SYBR Green PCR master mix | 10 | 176 |
qPCR forward primer 10 µM | 1 | 32 |
qPCR reverse primer 10 µM | 1 | 32 |
Template cDNA | 1 | - |
RNAse free water | 7 | (use H2O from RT) |
------------------------------------------------ | ---- | ----- |
Total | 20 |
qPCR Settings
File - New Assay
plate layout:
Filter: SYBR
Sample volume: 20
Probe: SYBR
Filter: N/A
Background: spec background
Highlight the wells you want to detect. Label as unknowns.
PCR Program:
Step | Temp | Time |
---|---|---|
PCR initial heat activation | 95 | 2 min |
Denaturation | 95 | 15 sec |
Primer annealing | 55 | 15 sec |
Extension | 68 | 20 sec |
Save the assay.
Press run (green arrow icon).
Plates: USA Scientific 1402-9500
Sealing film: 2921-0010
- Printer-friendly version
- Log in to post comments