!2022 (Maresca)

!2022 (Maresca) kdorfman Fri, 06/03/2022 - 18:13

Tom Maresca's first run of G&GA

class day date topics
1 W 9/7 Tom: Intro to the course
Kate: intro to safety, fluorescence microscope
live cell imaging on conA coverslip dishes
2 M 9/12 pipetting, S2 culture, microscopy
3 W 9/14 Transformation
4 M 9/19 mini prep, pcr
5 W 9/21 0.9% gel, band extraction
6 M 9/26 invitro transcription kit; conA dishes
7 W 9/28 gel, + Nanodrop
8 M 10/3 ds RNA treatment
9 W 10/5 16 conA dishes (Tom)
5 mL S2 aliquots
10 W 10/12 immunostaining
11 M 10/17 repeat ds RNA treatment
make 1 conA coverslip per student
12 W 10/19 IF (students seed coverslips and fix) on control and dsRNA treated cells
13 M 10/24 looking at coverslips (Ctrl vs treated)
14 W 10/26 presentations (in ILC?)
15 M 10/31 transformations (PXGFP); STLC (dishes); splitting demo
16 W 11/02 Miniprep, nanodrop, restriction digest (Bsb1)
17 M 11/07 gel, gel extraction (1 per student), anneal primers (1 per Group), isothermal reaction, Transformation of Competent Cells
45 min gel rather than 60 min?
15 min, not 15 sec on thermocycler for isothermal rxn
split HeLas while gels run
18 W 11/09 mini prep, (skip nanodrop)
1 uL 30 min test digest (BsmB1)
45 min test gel
split cells during either digest or gel, depending on lecture
19 M 11/14 transfection of HeLa cells
20 W 11/16 look at cells, notice transformation efficiencies
21 M 11/21 immunostaining w/ Rabbit anti-K167 (Tom to bring - what concentration?)(red secondary) & Rat anti-alpha Tubulin (Green secondary)
22 M 11/28 nucleofect Guide 1 & Guide 2 (122), or just Guide 2 into WT HeLas.
DON'T USE gfp-tubulin HeLas for this
23 W 11/30 Checked transfections in cover-slip bottom dish. Nucleofection effiiency Nuc blue
24 M 12/5 IF for Ki67 tubulin and dapi.
seed glass bottom dish to view next meeting. treat cells with nocodazole at 10 am before class W
25 W 12/7 1st hour: live cell imaging of nocodazole treated cells1 with NucBlue
rest of class: work on posters
26 M 12/12 Poster presentations in ILC (RESERVE ROOM)

  1. Make 10 mL of 3.3 nocodazole. 3 hours before class, remove 1 mL DMEM from each dish, replace with 1 mL 3.3uM nocodazole, for a final concentration of ~1.75 uM. Give students 1 mL aliquots of fluorobrite with 1.75 uM nocodazole and 20 drops/10 mL nucblue. ↩︎

2022 prep plans
creating epitope for anti-Ki67

Annealed primers

Annealed primers kdorfman Mon, 11/07/2022 - 19:31

Annealed primers for CRISPR sgRNA primers

for isothermal reaction (Gibson assembly)

master stock is 2905.2 ng/uL

5 uL aliquots of 1 ng/uL

ConA dishes for 383H

ConA dishes for 383H kdorfman Wed, 09/21/2022 - 20:18

Materials:

  • con A aliquots

  • cleaned (but not necessarily sterile coverslip dishes (check size so they'll fit into the adaptors for the microscope stage)

  • 10 mL S2 medium in a conical tube

Protocol

  • Students put conA in non-sterile dishes

  • When they split their cultures, they put 1 mL of cells into a microfuge tube.

  • In class, they put cells onto the treated coverslip, then add medium after they are stuck.

Immunostaining RNAi S2 cells

Immunostaining RNAi S2 cells kdorfman Fri, 09/30/2022 - 15:49

W 10/12/22

  • 1 con-A coverslip in a dish per student + backups (repeat day: 2 per group + backup)
  • coverslip forceps
  • 4% PFA
  • PBS-Tw-Azide
  • Rabbit anti-Phospho H3
  • Rat anti-tubulin
  • goat anti rabbit red (Cy3)
  • goat anti rat 488
  • DAPI mounting medium
  • nail polish

Materials

Materials kdorfman Fri, 09/02/2022 - 20:58

W 9/7:

  • S2 media for us
  • plate cells 15-20 min before class
    • 1/2 Con A (Tom supplied 12 dishes)
    • 1/2 untreated

PCR (383H 2022)

PCR (383H 2022) kdorfman Thu, 09/15/2022 - 20:42

Reagents

reagent uL per rxn uL aliquot for group of 3 to share
DNA template1 1 uL students use their own miniprep product
10 mM dNTPs 2 10
5X PFU buffer2 20 65
Primers3 20 mM 5 20
water (sterile) 66.5 250
Phusion Enzyme4 0.5 dispensed by instructor with a 2uL pipette

The PCR program is:

  1. 2 minutes at 95C
  2. 45 seconds at 95C (Denaturation)
  3. 45 seconds at 55C (Primer annealing)
  4. 60 seconds at 72C (Extension)
  5. Repeat steps 2-4 30X
  6. 10 minutes at 72C
  7. Forever at 4C

  1. Amount of DNA template may depend on final concentration of template DNA. If more than 1 ul of DNA needs to be used, reduce the amount of water in the reaction accordingly. ↩︎

  2. Use "HF Buffer" unless you have a difficult GC-rich template DNA. Then, you could change to the included "GC" Buffer. ↩︎

  3. KLP61 RNAi F: TAATACGACTCACTATAGGGTATTTGCGCATTATTTTAAAA
    KLP61 RNAi R: TAATACGACTCACTATAGGGATATTGATCAATTGAAAC ↩︎

  4. Fisher F530S Phusion High–Fidelity DNA Polymerase ↩︎

Maresca PCR Protocol
Phusion Manual

Reagents

Reagents kdorfman Fri, 08/26/2022 - 17:06
Reagent for part # ordered? received?
1 M Tris HCl pH 7.5 Isothermal mix no on buffer shelf
1 M MgCl2 Isothermal mix no on buffer shelf
10 mM dNTP isothermal mix Fisher R9012 no in RT reagents box (-20)
1M DTT isothermal mix Acros 426380500 no in refrigerator door
Peg 8000 isothermal mix Fisher 04344322 yes above chem bench prep room
NAD isothermal mix MP Biomedicals 02100499.1 yes
T5 exonuclease PCR Fisher M0663S yes Maresca freezer box
Phusion polymerase PCR Fisher F530S yes Maresca freezer box -20
Taq ligase PCR NEB M0208L yes Maresca freezer box
SiR Tubulin microtubule stain Fisher NC0958386 yes Maresca freezer box -20
T7 RiboMAX Express RNAi System RNAi expts Promega PRP1700 yes Maresca freezer box
Heat inactivated FBS S2 culture Fisher 10082147 yes freezer -20
Anti-anti S2 culture Fisher F530S no tissue culture aliquots freezer box
S2 medium S2 culture Fisher 21720-24 ordered 4 above fridge in tissue culture room
ZR plasmid miniprep S2 transformation D4015 yes above bench in prep room
reagent list

T7 RiboMAX

T7 RiboMAX kdorfman Wed, 09/21/2022 - 19:46

Transcription mix

Students make the transcription mix from the kit

1 reaction per group

Reagent Sample reaction
RiboMAX™ Express T7 2X Buffer 10 µL
linear DNA template (1µg total) 1– 8µL
Nuclease-Free Water 0–7µl
Enzyme Mix, T7 Express 2 µL
Final Volume 20 µL
T7-riboMAX protocol

Transformation (G&GA 2022)

Transformation (G&GA 2022) kdorfman Thu, 09/15/2022 - 15:11

Protocol

  • 25 uL competent cells l^*] (get from Tom's lab, or NEB C2988J)
  • 1 uL plasmid Klp61F (10-50 ng) (in plasmids box in 362A freezer)
  • ice 5 minutes
  • heat shock 42C 30sec
  • ice, bring volume to 1 mL with LB
  • shake (200 rpm) at 37C 20-30 min
  • Plate 200 uL on LB-Amp
  • Make a second plate:
    • Spin down remaining 800 uL,
    • Resuspend in 200 uL
    • plate on LB-Amp
  • incubate 37C overnight
  • instructors take plates and start liquid cultures from them for the students

Students need

  • 2 LB-Amp plates per pair

  • 1 mL LB per pair

  • sterile water

  • sterile beads

  • hot block at 42C

  • shaker at 37C, rigged with a slanted microfuge tube rack

  • plasmid Klp61F (do miniprep in advance if there is none in the plasmid box in 362A freezer

  • competent cells

  • markers

gel materials 383H F22

gel materials 383H F22 kdorfman Tue, 09/20/2022 - 14:20

0.9% agarose with sybr safe

TAE

Loading dye

Ladder

8 gel rigs, 8-well columns

blue light boxes, viewing shroud, orange filters