Genetics Lab

Genetics Lab kdorfman Tue, 01/03/2012 - 16:35

2021 F

2021 F kdorfman Wed, 08/25/2021 - 16:52

Fast Plant Seeds

Fast Plant Seeds kdorfman Wed, 08/25/2021 - 17:02

From Carolina Biological Supply

Type Description part no how many
F1 Rosette-Dwarf, Non-Purple Stem Seed (F1 Rosette, Anthocyaninless), Pack of 200 158885 3
F2 Rosette-Dwarf, Non-Purple Stem Seed (F2 Rosette, Anthocyaninless), Pack of 250 158895 1

Yeast Plates

Yeast Plates kdorfman Wed, 08/25/2021 - 17:07
Medium size (mm) number
YED 100 250
MV 100 150
MVADE 100 70
YEKAc 60 60

Yeast strains

Yeast strains kdorfman Wed, 08/25/2021 - 16:53

From Carolina Biological Supply

Name Description Item no Quantity
Saccharomyces cerevisiae, HA0 Strain a, wild type 173620 1
Saccharomyces cerevisiae, HB0 Strain alpha, wild type 173621 1
Saccharomyces cerevisiae, HA1 Strain a, ade1 173622 1
Saccharomyces cerevisiae, HB1 Strain alpha, ade1 173623 1
Saccharomyces cerevisiae, HA2 Strain a, ade2 173624 1
Saccharomyces cerevisiae, HAR Strain a, ade2 173625 1
Saccharomyces cerevisiae, HB2 Strain alpha, ade2 173626 1
Saccharomyces cerevisiae, HBR Strain alpha, ade2 173627 1
Saccharomyces cerevisiae, HA12 Strain a, ade1 ade2 173628 1
Saccharomyces cerevisiae, HB12 Strain alpha, ade1 ade2 173629 1

C. elegans

C. elegans kdorfman Mon, 01/09/2012 - 17:15

Protocol for making competent cells:

http://www.bio-protocol.org/wenzhang.aspx?id=143

Bacterial strains

Bacterial strains kdorfman Wed, 01/18/2012 - 21:58

From Dolan DNA learning center

Bacterial Strain Strain Description Details
HT115(DE3) HT115(DE3) E. coli RNAi feeding strain
HT115(DE3)/pL4400 Empty RNA1 feeding vector L4440 in feeding strain Ampicillin selection No phenotype
HT115(DE3)/pL4400(bli-1) blister-1 RNAi feeding strain induces blister by RNAi
HT115(DE3)/pL4400(dpy-10) dpy-10 RNAi feeding strain induces dumpy by RNAi
HT115(DE3)/pL4400(rol-5) rol-5 RNAi feeding strain induces roller phenoytpe by RNAi
HT115(DE3)/pL4400(T04A11.6) him-6 RNAi feeding strain induces high incidence of males by RNAi
HT115(DE3)/pL4400(unc-22) unc-22 RNAi feeding strain induces twitcher by RNAi
HT115(DE3)/pL4400(unc-23) unc-23 RNAi feeding strain induces uncoordination by RNAi
OP50 Uracil auxotroph E. coli B. feeding behavior for C. elegans

Competent cells

Competent cells kdorfman Thu, 01/19/2012 - 06:14

Protocol for making competent cells

Need competent cells for students in week 3 - make them in week 1 or 2.

0.5 M PIPES disodium salt(pH 6.7) (Alfa Aesar 3p B21835-22) or Fisher AC21509-1000

  • 17.3 g PIPES (disodium salt) in 80 mL H2O
  • OR 15.1 g PIPES in 80 mL H2O
  • initial pH = ~5.5
  • KOH pellets till it goes clear (checking pH!!)
  • final pH to 6.7 with 5M KOH
  • water to 100 mL
  • filter sterilize
  • freeze in 10 mL aliquots (enough for 500 mL transformation buffer)

Transformation buffer

Reagent cf (mM) per L .
MnCl2 55 10.88 g
CaCl2 15 2.2 g
KCl 250 18.65 g
PIPES (pH 6.7, 0.5M) 10 20 mL

filter sterilize. refrigerate


SOB Medium

Per Liter:

  • 950 ml of deionized H2O
    • 20 g Tryptone
    • 5 g Yeast Extract
    • 0.5 g NaCl
  • stir to dissolve
    • 2.5 mL 1M KCl (10 mL 250 mM KCl)
  • pH to 7 with NaOH
  • volume to 1 L
  • autoclave 20 min
  • cool
    • 10 mL sterile 1M MgCl (5 mL sterile MgCl2 2M)
    • ? 10 mL sterile 1M MgSO4?

SOB AGAR

15 g agar/L SOB

when cooled, add

20 mL 1 M MgSO4

12.5 µg/mL tetracycline (=0.83 mL 15 mg/mL tet per L)

or

50 µg/mL ampicillin as needed (= 1mL 50 mg/mL amp stock per L)

LB amp

LB amp kdorfman Wed, 02/08/2012 - 15:40

LB ampicilin plates for transformation

48 plates x 25 mL/plate = 1200 mL

Make 1500 mL:

25 g LB + 15 g agar /liter and 50 µg/mL ampicillin

http://wahoo.nsm.umass.edu/content/ampicillin

37.5 g LB in 1500 mL water in a 2L flask

stir to dissolve, leave stir bar in.

add 22.5 g agar

Autoclave 50 min. Include PourBoy tubing if necessary, and 2 flasks of water.

Cool till handle-able

Add 1500 µL 50 mg/mL amp

Stir

Dispense 25 mL/plate

NGM plates

NGM plates kdorfman Mon, 01/09/2012 - 17:26

Per Liter of medium (~75 plates):

  • 975 mL Water
  • 3 g NaCl
  • 2.5 g Peptone (Fisher BP1420-500 $78.80)
  • 17 g Bactoagar

This is what I did by mistake: per 1.5 L (112 plates):

  • 1462 mL Water
  • 18 g NaCl
  • 15 g Peptone (Fisher BP1420-500 $78.80)
  • 25.5 g Bactoagar (haven't added it yet)

So I labeled it NGM 4X.

I made 4 liters by diluting 975 mL 4xNGM with 975 x 3 mL water, then added 68 g bactoagar.

Stir flask to distribute ingredients.

Autoclave with stir bar inside

Cool to 55C in a 55C water bath

Add per L (see recipes in stock solutions):

  • 1 mL cholesterol (5 mg/mL in 95% EtOH)
  • 1 mL CaCl2 (1 M, STERILE)
  • 1 mL MgSO4 (1 M, STERILE)
  • 25 mL K-phosphate buffer (1M, pH 6.0, STERILE1)

Swirl flask to mix

Dispense 10 mL into each 60mm dish.

Stack 10 high

Let stand for ~48 hours for condensation to evaporate

Pack in sterilized plastic boxes.


  1. 3.3 mL K2HPO4 + 21.7 mL KH2PO4 ↩︎

OP broth

OP broth kdorfman Tue, 01/10/2012 - 16:15

B Broth (for OP50 E. coli to feed to worms)

  • 10 g bactotryptone
  • 5 g NaCl
  • 1 L dH2O

Autoclave

400 µL overnight culture to seed plates.

Store for months in refrigerator.

200 mL cells ON for 500 plates

(can save the extra ON culture in the refrigerator for 3 days.)

From WormBase:

3.1. Preparation of bacterial food source

Although C. elegans can be maintained axenically (Avery, 1993), it is difficult, and the animals grow very slowly. C. elegans is usually grown monoxenically in the laboratory using E. coli strain OP50 as a food source (Brenner, 1974). E. coli OP50 is a uracil auxotroph whose growth is limited on NGM plates. A limited bacterial lawn is desirable because it allows for easier observation and better mating of the worms. A starter culture of E. coli OP50 can be obtained from the CGC or can be recovered from worm plates. Use the starter culture to isolate single colonies on a streak plate of a rich medium such as LB agar [10 g Bacto-tryptone, 5 g Bacto-yeast, 5 g NaCL, 15 g agar, H2 O to 1 litre, pH 7.5] (Byerly et al., 1976). Using a single colony from the streak plate, aseptically inoculate a rich broth, such as L Broth [10 g Bacto-tryptone, 5 g Bacto-yeast, 5 g NaCl, H2 O to 1 litre, pH to 7.0 using 1 M NaOH. Put 100 ml into 250 ml screw-cap bottles and autoclave. The bottles of media can be stored at room temperature for several months (Byerly et al., 1976)]. Allow inoculated cultures to grow overnight at 37°C. The E. coli OP50 solution is then ready for use in seeding NGM plates. The E. coli OP50 streak plate and liquid culture should be stored at 4°C and will remain usable for several months.

Drosophila

Drosophila kdorfman Wed, 01/04/2012 - 17:09

Drosophila culturing

Craig Woodard estimates they use 50 bottles and about 800 vials for 100 students for their drosophila mapping lab.

http://flystocks.bio.indiana.edu/Fly_Work/supplies.htm

http://flystocks.bio.indiana.edu/Fly_Work/culturing.htm

FOOD

Carolina 4-24 no-cook ready mix: 173204

4 4-L bags for ~$80

1 L makes 85 vials = 1360 vials @ ~$0.06


VIALS

standard size is "narrow" 25 x 95 mm

  • K-Resin and polypropylene vials are virtually unbreakable, scratch and mar resistant;
  • polystyrene and K-Resin vials have glass-like clarity
  • Polypropylene vials are autoclavable; polystyrene and K-Resin are nonautoclavable

Fisher:

Applied Scientific Drosophila Products Shell Vials

K-resin bulk packed 500 @ ~$92 ($0.18 each)

racked 500 @ ~$113 ($0.23 each)

flystuff

http://www.flystuff.com/vials.php

Register with Genesee Scientific

K-resin bulk packed 500: $96

tritech

http://www.tritechresearch.com/T3808.html

K-Resin narrow diam. vial (500/cs) - tray

$60.54 + $19 to ship! (=$80)

$49.73 † - 4 or more.

http://www.tritechresearch.com/T3809.html

T3809

K-Resin narrow diam. vial (500/cs) - bulk

$54.05 † - Regular price.

$43.24 † - 4 or more.

Dot Scientific

https://www.dotscientific.com/disposable.asp?scat=167

DP-9508 K-Resin narrow vial 500/CA : $60

  • $5 handling

Bloomington acct

Bloomington acct kdorfman Thu, 01/12/2012 - 16:17

Apparently lost account info from 12/30/11. Re-entered 1/12/12

http://fly.bio.indiana.edu/bloomhome.htm

Your Message Has Been Sent Below is what you submitted on Thursday, January 12, 2012 at 10:54:27


Purpose: Teaching

Organization Type: Higher Education Teaching

Organization Name: University of Massachusetts, Amherst

Website: http://www.bio.umass.edu/biology/

Account Type: APSingle

Honorific: Dr.

Account Holder First Name: Katherine

Account Holder Last Name: Dorfman

Mailing Address for Shipments: Katherine Dorfman 661 N Pleasant St ISB 241C University of Massachusetts Amherst, MA 01003

Import Permit: No

DNA extract

DNA extract kdorfman Mon, 03/12/2012 - 15:12

Isolating, digest out the P-element, Ligate P-element line DNA

Use Qiagen DNeasy Blood & Tissue Kit 69504 $141.12 for 50 reactions

LiCl/KAc

LiCl/KAc kdorfman Mon, 03/12/2012 - 18:01

LiCl/KAc

1 part 5M KAc : 2.5 parts 6M LiCl

Stock solution 14 17.5 21 mL final volume
5M KAc 4 5 6 mL
6M LiCl 10 12.5 15 mL

Ligase

Ligase kdorfman Mon, 03/12/2012 - 18:03

T4 DNA Ligase

NEB M0202S

Get from New England Biolabs Freezer Program in Fernald

Store in freezer

Comes with 10X ligase buffer (includes ATP

NaOAc

NaOAc kdorfman Mon, 03/12/2012 - 18:06

3M NaOAc

PBS for DNA

PBS for DNA kdorfman Mon, 03/12/2012 - 18:04

PBS

~200 mL/prep

4 preps per group

Aliquot 1 mL per group

Soution A

Soution A kdorfman Mon, 03/12/2012 - 18:00

Solution A

100 mM Tris-HCl pH 7.5

100mM EDTA

100 mM NaCl

0.5% SDS

Stock solution 10 25 50 100 mL final volume
1 M Tris 1 2.5 5 10 mL
0.5 M EDTA 2 5 10 20 mL
5 M NaCl 0.02 0.05 0.1 0.2 mL
20% SDS 0.25 0.625 1.25 2.5 mL

Make 10 mL

pH to 7.5

Gel Extraction

Gel Extraction kdorfman Mon, 04/02/2012 - 18:57

Extraction prep

Extraction prep kdorfman Mon, 04/02/2012 - 19:05

Equipment

  • razor blades
  • transilluminators
  • face shields
  • cutting boards
  • dry bath at 50C
  • columns & collection tubes

Solutions

  • Add ethanol to Buffer PE
  • Buffer QG ~2 mL (steps 4 & 8)
  • isopropyl - ~0.5 mL
  • NaOAc 3M, pH 5.0 ~25 µL
  • Buffer PE ~ 1.75 mL
  • Buffer EB ~ 75 µL (=Tris-Cl 10 mM pH 8.5)
  • 6x loading dye
  • 6 gels 1.5% (= 300 mL TAE + 4.5 g agarose + 3 µL EtBr)

protocol

protocol kdorfman Mon, 04/02/2012 - 19:08

QIAquick Gel Extraction Kit

(cat. nos. 28704 and 28706) store at room temperature (15°–25°C) for a year

www.qiagen.com/handbooks.

Notes before starting

  • The yellow color of Buffer QG indicates a pH7.5.
  • Add ethanol (96%–100%) to Buffer PE before use (see bottle label for volume).
  • Isopropanol (100%)
  • heating block or water bath at 50°C
  • All centrifugation steps are carried out at 17,900 x g (13,000 rpm) in a microcentrifuge.

Protocol

  1. Excise the DNA fragment from the agarose gel with a clean, sharp scalpel.
  2. Weigh the gel slice in a colorless tube. Add 3 volumes Buffer QG to 1 volume gel (100 mg ~ 100 µL). (For >2% agarose gels, add 6 volumes Buffer QG.)

  3. Incubate at 50°C for 10 min (or until the gel slice has completely dissolved). Vortex the tube every 2–3 min to help dissolve gel.

  4. After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose). If the color of the mixture is orange or violet, add 10 µL 3 M sodium acetate, pH 5.0, and mix. The color of the mixture will turn yellow.
  5. Add 1 gel volume of isopropanol to the sample and mix.
  6. Place a QIAquick spin column in a provided 2 mL collection tube or into a vacuum manifold.
  7. To bind DNA, apply the sample to the QIAquick column and centrifuge for 1 min or apply vacuum to the manifold until all the samples have passed through the column. Discard flow-through and place the QIAquick column back into the same tube. For sample volumes of >800µL, load and spin/apply vacuum again.

  8. If the DNA will subsequently be used for sequencing, in vitro transcription, or microinjection, add 0.5 mL Buffer QG to the QIAquick column and centrifuge for 1 min or apply vacuum. Discard flow-through and place the QIAquick column back into the same tube.

  9. To wash, add 0.75 mL Buffer PE to QIAquick column and centrifuge for 1 min or apply vacuum. Discard flow-through and place the QIAquick column back into the same tube. Note: If the DNA will be used for salt-sensitive applications (e.g., sequencing, blunt-ended ligation), let the column stand 2-5 min after addition of Buffer PE.

  10. Centrifuge the QIAquick column once more in the provided 2 mL collection tube for 1 min at 17,900g (13,000 rpm) to remove residual wash buffer.

  11. Place QIAquick column into a clean 1.5 mL microcentrifuge tube.
  12. To elute DNA, add 50 µL Buffer EB (10 mM Tris·Cl, pH 8.5) or water to the center of the QIAquick membrane and centrifuge the column for 1 min. For increased DNA concentration, add 30 µL Buffer EB to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min. After the addition of Buffer EB to the QIAquick membrane, increasing the incubation time to up to 4 min can increase the yield of purified DNA.
  13. If the purified DNA is to be analyzed on a gel, add 1 volume of Loading Dye to 5 volumes of purified DNA. Mix the solution by pipetting up and down before loading the gel.

Genotyping

Genotyping kdorfman Mon, 03/26/2012 - 15:51
  • 10.0 ul Ligated genomic DNA (~1/15 fly)
  • 2.0 ul 2mM each dNTP
  • 1.0 ul 10uM forward primer,* Plac4*
  • 1.0 ul 10uM reverse primer, *Plac1 *
  • 5.0 ul 10X Taq buffer
  • 31.0 ul ddH20
  • 0.4 ul 2 units Taq

Perform thermal cycling for recovery of 5' flanking as follows:

Cycle Temp Time # cycles

94C 3 min 1

  • Denature 94C 30 sec
  • Anneal 60C 1 min 35
  • Extend 68C 2 min

72C 10 min 1 4C HOLD

PCR Reaction to amplify 3' Flanking Sequence

  • 10.0 ul Ligated genomic DNA (~1/15 fly)
  • 2.0 ul 2mM each dNTP
  • 1.0 ul 10uM forward primer, Pry4
  • 1.0 ul 10uM reverse primer, *Plw3-1 *
  • 5.0 ul 10X Taq buffer
  • 31.0 ul ddH20
  • 0.4 ul 2 units Taq

Perform thermal cycling for recovery of 5' flanking as follows:

Cycle Temp Time # cycles

94C 3 min 1

  • Denature 94C 30 sec
  • Anneal 55C 1 min 35
  • Extend 68C 2 min

72C 10 min 1 4C HOLD

Sequencing

Sequencing kdorfman Mon, 04/02/2012 - 17:50

Primers for the 5'

  • Splac2 25mer GAATTCACTGGCCGTCGTTTTACAA

  • Sp1 22mer ACACAACCTTTCCTCTCAACAA

Primers for the 3'

  • Spep1 19mer GACACTCAGAATACTATTC

  • Sp6 23mer TGACCACATCCAAACATCCTCTT

Melting Temps for sequencing primers

  • Splac2 60.1C

  • Sp1 50.6C

  • Sp6 54.9C

  • Spep1 44.8C

sequencing results

sequencing results kdorfman Tue, 04/10/2012 - 18:21

Get Ape (A Plasmid Editor) for Mac to read the sequences (if it isn't installed already)

http://biologylabs.utah.edu/jorgensen/wayned/ape/

Strains

Strains kdorfman Thu, 01/12/2012 - 16:45

Order from Bloomington

shipping schedule: http://flystocks.bio.indiana.edu/Distribution/shipping.htm

order form: http://flystocks.bio.indiana.edu/Distribution/Order/searchbun.html

P-element lines to map:

Stock # Name
12039 P{lacW}Cka[s1883]
12176 P{lacW}lace[k05305]
11118 P{lacW}geminin[k14019]
12304 P{lacW}wah[j2E5]
31996 P{lacW}Klc[59A]
12211 P{lacW}Idh[L3852]

Mapping stocks and controls:

Stock # Name
1882 w[*]; al[1] b[1] c[1] sp[1]/CyO, P{sevRas1.V12}FK1
462 w[1118]; h[1] kni[ri-1] e[s]
3605 w1118 control
1 Canton-s control

Genetics schedule

Genetics schedule kdorfman Wed, 01/18/2012 - 20:15

2012 schedule

1/24 - Flies

1/24 - Flies kdorfman Wed, 01/18/2012 - 20:17

Night before:

clear vials of wildtype Canton-S, put at 18C for virgins in the morning

12 vials WT Canton-S

12 vials of mutant, mapping stock flies

Get fly nap from EH&S

Try sharing funnel apparatus, with fly nap on the cotton in the Coplin jar

1/31 Worms

1/31 Worms kdorfman Wed, 01/18/2012 - 20:19
  • 12 plates N2 normal worms
  • 1 plate each mutation
  • alcohol lamps
  • at least 12 picks (from Dave)

2/6 (M)

2/6 (M) kdorfman Wed, 01/18/2012 - 20:29

Start overnight of RNAi plasmid containing bacteria:

  • pL4440 empty
  • pL4440 + lsy-2
  • pL4440 + choice

Plates of bacteria with:

  • pL4440 empty
  • pL4440 + lsy-2 (chemo assay)

Groups will choose one of the following for phenotypic analysis:

  • pL4440 + bli-1
  • pL4440 + dpy-5
  • pL4440 + unc-22 (from Chase Lab)

10 mL per overnight of sterile LB + 12.5 µg/mL tetracycline

Adding 10 µL of 50 mg/mL ampilicillin stock

  • 15 mL conical tubes for overnight, 3 per group, so 36 tubes = 360 mL of broth minimum
  • Sterile toothpicks

2/7 PCR & isolate DNA

2/7 PCR & isolate DNA kdorfman Wed, 01/18/2012 - 20:38

Set up PCR to verify plasmid inserts

Isolate plasmid DNA from bacteria

Outside class: Begin collecting virgin females from the P- element lines this week

PCR reagents

  • Invitrogen T7 Promoter Primer Catalog Number N560-02 (forward primer, 20uM)
  • 5 µL sterile water
  • PCR buffer
  • 50 mM MgCl2
  • 10 mM dNTP mix
  • Taq polymerase (5U/µL)

PCR engine parameters

  • 94 C 5 min
  • 94 C 30 sec
  • 55 C 30 sec
  • 72 C 3 min
  • repeat 30 x
  • 72 C 6 min
  • (protocol says 4C, should just be END) Note - can just stop, cold promotes condensation, and the product is sterile

DNA Isolation reagents

  • Solution 1 (~7.2 mL minimum)
    • 50 mM glucose
    • 10 mM EDTA
    • 25 mM Tris, pH 8
  • Solution 2 (14.4 mL minimum)
    • 0.2 M NaOH
    • 1% SDS *Solution 3 (~10.8 mL minimum)
    • 2.7 M KoAc
    • 6.6 M acetic acid
  • 100% EtOH
  • 80% EtOH
  • sterile water

Speed Vac??

Pre-semester prep

Pre-semester prep kdorfman Tue, 01/03/2012 - 16:38

Stuff to get

6 more ether jars for flies

brushes

vials

food

Stuff to do

See about switching rooms with Peg

pL440 plasmid

pL440 plasmid kdorfman Wed, 01/25/2012 - 21:49

these are the sequencing primers for the pL4440 plasmid

forward: CCTTTGAGTGAGCTGATACC

reverse: TTAAGTTGGGTAACGCCAGG

he said 1ul per 25ul sequencing reaction....