PCR 2024

Submitted by kdorfman on Wed, 09/11/2024 - 22:17

Reagents

100 uL reaction; 1 reaction per student

reagent uL per rxn uL aliquot for group of 3 to share
DNA template1 1 uL students use their own miniprep product
10 mM dNTPs 2 10
5X Phusion buffer2 20 65
Primers3 20 mM 5 20
water (sterile) 66.5 250
Phusion Enzyme4 0.5 dispensed by instructor with a 2uL pipette

The PCR program5 is:

  1. 2 minutes at 95C
  2. 30 seconds at 95C (Denaturation)
  3. 30 seconds at 55C (Primer annealing)
  4. 30 seconds at 72C (Extension)6
  5. Repeat steps 2-4 30X
  6. 10 minutes at 72C
  7. Forever at 4C

  1. Amount of DNA template may depend on final concentration of template DNA. If more than 1 ul of DNA needs to be used, reduce the amount of water in the reaction accordingly. Check concentrations with Nano-drop just to see that they got plasmid. ↩︎

  2. Use "HF Buffer" unless you have a difficult GC-rich template DNA. Then, you could change to the included "GC" Buffer. ↩︎

  3. KLP61 RNAi F: TAATACGACTCACTATAGGGTATTTGCGCATTATTTTAAAA
    KLP61 RNAi R: TAATACGACTCACTATAGGGATATTGATCAATTGAAAC
    stock is 500 mM ↩︎

  4. Fisher F530S Phusion High–Fidelity DNA Polymerase; Switch to NEB M0530L ↩︎

  5. on Thermocycler 1, Folder G&GA, program G_GA2022 ↩︎

  6. Extension time rule of thumb for Phusion: 15-30 seconds per KB;
    Our product will be 500 bp, so we set extension to 30 sec ↩︎

2024 383 PCR
Phusion User Manual