QBoC

QBoC kdorfman Wed, 10/12/2011 - 15:35

2020 remote learning lab

2020 remote learning lab kdorfman Fri, 08/07/2020 - 15:42

1 - Pollen

1 - Pollen kdorfman Fri, 08/07/2020 - 15:43

Make LPGM

with 5%, 7%, and 10% sucrose

Incubate briefly in LPGM in a 2 mL tube in the Ferris wheel, at a slow spin speed, parallel to the direction of rotation so the tube goes upside down and the liquid moves from top to bottom of the tube.

Can image at 4x on a poly-lysine coated slide . Make a vaseline circle, put some pollen suspension inside it, cover with coverslip.

Set up time-lapse imaging: 20 images every 5 minutes. Find a field of view with several pollen grains in focus at once, all starting to germinate.

In a multiwell plate The surface of one well of a 12 well plate can be covered by as little as 400uL water.

Need to cover with poly-lysine. Already have ~50 mL of 0.1% working solution.

So can coat ~125 wells

Well diameter = ~22 mm

In a cover-slip bottom 60 mm dish

500 uL coats the well.

Coverslip diameter = 30 mm

How many unique fields of view can we get in one dish?

Pollen tubes grow ~0.2 um/sec = 12um/min = 0.012 mm/min

magnification field diam (mm) field diam (um)
4x 5 5000
10x 2.2 2200
40x 1.1 1100

Reasonably good optics at 10x; camera adds magnification.

Coat all wells on 3 12-well plates, one for each concentration of sucrose.

2 - Molecular Biology

2 - Molecular Biology kdorfman Fri, 08/07/2020 - 15:43

Bacterial plasmids:

  • H2B-mCherry (Addgene 20972) (Kan resistant)
  • ecadherinGFP (Addgene 28009) (Kan resistant)

Restriction Enzymes

  • PvuI-HF (cut smart)
  • BamHI-HF (cut smart)
  • KpnI-HF (cut smart)

A "Typical" Restriction Digest

Reagent amount
Restriction Enzyme 10 units is sufficient, generally 1 µl
DNA 1 µg
10X NEBuffer 5 µl (1X)
Total Reaction Volume 50 µl
Incubation Time 1 hour
Incubation Temperature Enzyme dependent

Gel Loading

  • 1 % agarose in TAE
  • 1/10,000 SYBR Safe
  • 20 wells
  • wide gel
  • 10 uL/well

Lanes 1, 10, 20 have NEB 1Kb ladder mixed in this ratio

  • 1 uL ladder
  • 1 uL loading dye
  • 6 uL water
Tube 2 3 4 5 6 7 8 9
Ingredient uncut control BamH1 KPN1 Pvu1 BamH1 + Kpn1 BamH1+Pvu1 Kpn1+Pvu1 BamH1+Kpn1+Pvu1
10X NEBuffer 5 5 5 5 5 5 5 5
plasmid 20972 3 3 3 3 3 3 3 3
BamH1 0 1 0 0 1 1 0 1
KPN1 0 0 1 0 1 0 1 1
PVU1 0 0 0 1 0 1 1 1
water 42 41 41 41 40 40 40 39
Tube 11 12 13 14 15 16 17 18
Ingredient uncut control BamH1 KPN1 Pvu1 BamH1 + Kpn1 BamH1+Pvu1 Kpn1+Pvu1 BamH1+Kpn1+Pvu1
10X NEBuffer 5 5 5 5 5 5 5 5
plasmid 28009 9 9 9 9 9 9 9 9
BamH1 0 1 0 0 1 1 0 1
KPN1 0 0 1 0 1 0 1 1
PVU1 0 0 0 1 0 1 1 1
water 46 45 45 45 44 44 44 43

Restriction sites

Plasmid Bam1 Kpn1 Pvu1 plasmid length
20972 (H2B) 1724 2117 3567 6476
28009 (ecadherin GFP) 3703 3059 6007 8820

Digest fragments

Plasmid BamH1 + Kpn1 BamH1+Pvu1 Kpn1+Pvu1 BamH1+Kpn1+Pvu1
20972 (H2B) 393, 6083 1843, 4633 1450, 5026 393, 1450, 4633
28009 (ecad) 646, 8174 2304, 6516 2948, 5872 646, 2304, 5870

3 - Bacterial growth

3 - Bacterial growth kdorfman Fri, 08/07/2020 - 15:44

Grow bacteria

Streak frozen cells on agar plate

Pick a colony and grow overnight in liquid LB (plus antibiotic if necessary)

Concentrate ON culture in centrifuge

Make 2 dilution series: 10-fold, 2-fold

  • 2 fold

    • tubes 1A - 10A
    • 0.5 mL LB in each
    • add .5 mL culture to first, mix thoroughly
    • serially dilute by moving 0.5 mL along the series*
  • 10 fold

    • tubes 1B - 10B
    • 0.9 mL LB in each
    • add .1 mL culture to first, mix thoroughly
    • serially dilute by moving 0.1 mL along the series

Take OD measurements

  • Load 250 uL of each dilution into 96 well plate
  • samples in 1st 10 wells of 1st 2 rows
  • LB in last 2 wells
  • Read, using bug OD

Plot results

  • Put fraction of original culture next to each OD
  • Cut, paste special, values only
  • Sort data
  • Make a scatterplot
  • Find the lowest concentration just above the noise for hemocytometer

Hemocytometer

  • Load 10 uL into hemocytometer.
  • Photograph.
  • Also take photographs of too concentrated and too dilute samples

Colony Counts

  • spread 100 uL from last 5 10-fold dilutions on agar plates
  • Grow overnight
  • Photograph

4 - Lac Operon

4 - Lac Operon kdorfman Fri, 08/07/2020 - 15:45

Qualitative lac operon experiment

Grow GFP E. coli in different sugar media, then photograph in a 12 well plate on a blue light box through the orange filter.

  • Streak GFP E. coli on an LB-glucose-kan plate, grow overnight

  • Pick a colony, grow in overnight in liquid LB-glucose-kan (to prevent it turning green)

  • Spin down the ON culture (take a picture of the pellet for other use!)

  • Rinse several times (to get rid of the glucose)

  • Fill 12 well plate as indicated below. 2 mL per well:

additive none IPTG 0.01mM lac 0.25M gal 0.25M
none
glu 0.25M
mal 0.25M
  • Photograph
    • in white light
    • in blue light
  • Read in plate reader for blanks (OD and FL)

    • 12-well plate is too tall for reader!!!
    • Sample 100 uL of each to read blanks (OD & FL in a 96 well plate)
  • Inoculate each well with a small amount of culture.

  • Incubate on the shaker.

  • Photograph

    • in white light
    • in blue light
  • Read in plate reader (OD and FL)
    • Take 100 uL (?) samples to read in 96 well plate

Media

Need enough for the qualitative experiment ~5 mL each

Need enough for the quantitative experiment: 96 well plate @ 250 uL/well = ~25 mL total

Make 25 mL of each high concentration stock; mix the combinations from that

Add 50 µg/mL Kanamycin as indicated here.

2021

2021 kdorfman Tue, 08/17/2021 - 18:03
Lab Topic Date Date
lab 1.1 serial dilutions Th 9/2 Tu 9/7
lab 1.2 fluorescein absorbance Th 9/9 Tu 9/14
lab 1.3
lab 2.1
Fl data
miniprep
Th 9/16 Tu 9/21
lab 2.2 restriction digest Th 9/23 Tu 9/28
lab 2.3 digest analysis Th 9/30 Tu 10/5
lab 3.1 counting bacteria Th 10/7 Tu 10/12
lab 3.2 bacterial growth Th 10/14 Tu 10/19
lab 4.1 qualitative lac operon Th 10/21 Tu 10/26
lab 4.2 quantitative lac operon Th 10/28 Tu 11/2
lab 4.3 lac operon data Th 11/4 Tu 11/9
lab 5.1 Tu 11/16 Th 11/18
lab 5.2 Tu 11/23 (Th sect) Tu 11/30
lab 5.3 Th 12/2 Tu 12/7

Lab 1.1 prep

Lab 1.1 prep kdorfman Wed, 08/25/2021 - 20:01

For 9/2 & 9/7 2021

Lab 1.1 protocol

  • Pipetters & tips
  • trash bucket
  • Balances
  • water beaker
  • liquid waste bucket
  • gloves
  • Fluorescein 1 mM (~5 mL)
  • 12 glass tubes in rack
  • white and black strips behind rack
  • yellow filters
  • blue flashlights

Lab 1.3 prep

Lab 1.3 prep kdorfman Wed, 08/25/2021 - 20:43

9/16 & 9/21 2021

  • tube to mix 2 mL

  • rack to hold tubes: fluorescein stock tube, NaOH tube, dilution tube

  • 1 mM fluorescein in 10mM NaOH

  • 10mM NaOH

  • 96 well fluorescence plate (can use saved plate)

  • tape & marker

  • liquid waste beaker

  • tips & other dry trash beaker

  • two unknown fluorescein concentrations (one too dilute for Abs, one too concentrated for FL)

label ~mM Abs FL
P 0.0001 ~0 210
Q 0.015 0.8699 16496
R 0.1 4.955 26780

Lab 2.1 prep

Lab 2.1 prep kdorfman Wed, 08/25/2021 - 20:44

9/16 & 9/21 2021

2020 experiment

Bacterial plasmids:

  • H2B-mCherry (Addgene 20972) (Amp resistant) (Labeled A)
  • ecadherinGFP (Addgene 28009) (Amp resistant) (Labeled B) GROWS SLOWLY! ALLOW EXTRA TIME!
for Th lab for Tu lab prep
Monday 9/13 same streak each strain onto LB Amp plate; incubate ON
Tues 9/14 same plates to fridge; re-streak if necessary
Wed 9/15 Mon 9/20 pick colony, start liquid ON culture in 100 mL LB-Amp (one of each strain)
Th 9/16 Tu 9/21 Concentrate cells (max speed >10 min), then aliquot ~1 mL per pair of each strain

Mini-Prep

  • micro pipetters & tips
  • labeled racks in fridge
  • 1 mL each E. coli culture (concentrated by centrifugation) per pair
  • centrifuges
  • Miniprep kits - aliquot miniprep reagents per pair:

    • sterile microfuge tubes
    • 250 uL Buffer P1(+ RNaseA+LyseBlue)/rxn = 510 uL per pair
    • 250 uL Buffer P2/rxn = 510 uL per pair
    • 350 uL Buffer N3/rxn = 710 uL per pair
    • 2 QIAprep spin columns
    • 0.5 mL Buffer PB/rxn = 1.1 mL/pair
    • 0.75 mL Buffer PE/rxn = 1.51 mL
    • 50 uL Buffer EB (10 mM Tris-Cl pH 8.5) per rxn = 110 uL per pair
    • sterile water

Lab 2.2 prep

Lab 2.2 prep kdorfman Wed, 08/25/2021 - 20:44

Restriction Digest

9/23 & 9/28 2021

2020 experiment

Bacterial plasmids:

  • H2B-mCherry (Addgene 20972) (Kan resistant)
  • ecadherinGFP (Addgene 28009) (Kan resistant)

Restriction Enzymes

  • PvuI-HF (cut smart)
  • BamHI-HF (cut smart)
  • KpnI-HF (cut smart)

A "Typical" Restriction Digest

Reagent amount
Restriction Enzyme 10 units is sufficient, generally 1 µl
DNA 1 µg
10X NEBuffer 5 µl (1X)
Total Reaction Volume 50 µl
Incubation Time 1 hour
Incubation Temperature Enzyme dependent

Gel Loading

  • 1 % agarose in TAE
  • 1/10,000 SYBR Safe
  • 10 uL/well

NEB 1Kb ladder mixed in this ratio

  • 1 uL ladder
  • 1 uL loading dye
  • 6 uL water
Tube 2 3 4 5 6 7 8 9
Ingredient uncut control BamH1 KPN1 Pvu1 BamH1 + Kpn1 BamH1+Pvu1 Kpn1+Pvu1 BamH1+Kpn1+Pvu1
10X NEBuffer 5 5 5 5 5 5 5 5
plasmid 20972 3 3 3 3 3 3 3 3
BamH1 0 1 0 0 1 1 0 1
KPN1 0 0 1 0 1 0 1 1
PVU1 0 0 0 1 0 1 1 1
water 42 41 41 41 40 40 40 39
Tube 11 12 13 14 15 16 17 18
Ingredient uncut control BamH1 KPN1 Pvu1 BamH1 + Kpn1 BamH1+Pvu1 Kpn1+Pvu1 BamH1+Kpn1+Pvu1
10X NEBuffer 5 5 5 5 5 5 5 5
plasmid 28009 9 9 9 9 9 9 9 9
BamH1 0 1 0 0 1 1 0 1
KPN1 0 0 1 0 1 0 1 1
PVU1 0 0 0 1 0 1 1 1
water 46 45 45 45 44 44 44 43

Lab 2.3 prep

Lab 2.3 prep kdorfman Wed, 08/25/2021 - 20:45

9/30 & 10/5 2021

Lab 3.1 prep

Lab 3.1 prep kdorfman Wed, 08/25/2021 - 20:46

10/7 & 10/12 2021

Wet materials:

Equipment

  • hemocytometers
  • glass beads
  • beaker for used beads at each table
  • tips beaker
  • liquid waste beaker
  • microfuge tubes & rack
  • marker
  • clear 96 well plate
  • pipetters & tips

Plate reader program

  • BUG_OD
  • 1st 2 rows

Lab 3.2 prep

Lab 3.2 prep kdorfman Wed, 08/25/2021 - 20:46

10/14 & 10/19 2021

Give them the Excel growth curves.

Consider doing a 37C growth curve as well.

Lab 4.1 prep

Lab 4.1 prep kdorfman Wed, 08/25/2021 - 20:47

10/21 & 10/26 2021

  • sterilize 12 small flasks for cultures
  • sterilize at least 288 glass culture tubes

See prep for 2015

See LB sugar recipes

  • Make 50 mL of each mixture
  • Put 25 mL into flask for shaking incubator
  • Save the other 25 mL for the second section (in case you need to grow more cells.
  • Make 12 2 mL aliquots - one set per pair

See E. coli for Lac operon

Spread glucose + Kan on plain LB plate, then

Streak incubate overnight, and pick a colony into each medium.

Allow to grow, but not too long! Over day, but not over night?

Put out blue flashlights and yellow filters

Lab 4.2 prep

Lab 4.2 prep kdorfman Wed, 08/25/2021 - 20:47

10/28 & 11/2 2021

Lab 4.3 prep

Lab 4.3 prep kdorfman Wed, 08/25/2021 - 20:48

11/4 & 11/9 2021

Lab 5.1 prep

Lab 5.1 prep kdorfman Wed, 08/25/2021 - 20:48

11/16 & 11/18 2021

Lab 5.2 prep

Lab 5.2 prep kdorfman Wed, 08/25/2021 - 20:49

11/23 (Thursday section) & 11/30 2021

Lab 5.3 prep

Lab 5.3 prep kdorfman Wed, 08/25/2021 - 20:49

12/2 & 12/7 2021

1 fluorescein

1 fluorescein kdorfman Mon, 08/19/2013 - 17:09

1.1

1.1 kdorfman Mon, 08/19/2013 - 17:14

Materials

  • one balance per table (borrow from Bill Schmitt)
  • weighboats
  • non-sterile tips
  • Mats
  • Gloves
  • small glass culture tubes (~15/pair)
  • rack for tubes
  • beaker for water

  • blue flashlights & yellow filters

Computers and Plate Readers

  • Check program Repeatability (Abs 485 nm; layout A1-B12)
  • Wahoo folders must be named Tues01, Tues02, ...Tues12 and Thur01, Thur02 ... Thur12, even though the user names in the Optima program are Tue01 and Thu01, etc.
  • Import program to groups
  • Check network connections (in “my computer” connect the Z drive to Wahoo as kdorfman, kd@ISB)

10mM NaOH

MW = ~40

10mM = 0.01M = 0.4g/L

To make M NaOH/
with g NaOH pellets
use L H2O


1 mM Fluorescein

in 10 mM NaOH

It fades with time, so check the concentration of the old stocks.

MW = 332

1mM = 0.332g/L = 0.033g/100 mL

A = Ecl

Molar extinction coefficient of fluorescein at 485nm = 50358/mol.cm

so Absorbance 10^-5M = 0.50358

(1/100 of a 1mM solution =10^-5M)

1.2

1.2 kdorfman Mon, 08/19/2013 - 17:18

Absorbance of Fluorescein

Per pair:

  • Black 96 well plate (not necessarily sterile, but clean)
  • 1 mM fluorescein (~ 1 mL)
  • 10 mM NaOH (~ 4.5 mL)
  • 2 2-mL tubes to make 2 mL of 10µM fluorescein (each partner does one)

Computers and Plate Readers

  • Check program Repeatability (Abs 485 nm; layout A1-B12, volume 150 µL)
  • Check program FL-Abs-by-2 (Abs 485 nm; layout C1-2, D1-12, volume 150 µL)
  • Wahoo folders must be named Tues01, Tues02, ...Tues12 and Thur01, Thur02 ... Thur12, even though the user names in the Optima program are Tue01 and Thu01, etc.
  • Import program to groups
  • Check network connections (in “my computer” connect the Z drive to Wahoo as kdorfman, kd@hh3)

solutions

solutions kdorfman Fri, 09/06/2013 - 18:47

1 mM Fluorescein

in 10 mM NaOH

It fades with time, so check the concentration of the old stocks.

MW = 332

1mM = 0.332g/L = 0.033g/100 mL

A = Ecl

Molar extinction coefficient of fluorescein at 485nm = 50358/mol.cm

so Absorbance 10^-5M = 0.50358

(1/100 of a 1mM solution =10^-5M)


10mM NaOH

MW = ~40

10mM = 0.01M = 0.4g/L

1.3

1.3 kdorfman Mon, 08/19/2013 - 17:18

Corrections

Read the plate only once

Pipet 150 µL of each unknown in E3 - 12 as needed

Programs

  • Serial2&5_Abs
  • Serial2&5_FL
  • E1 &E2: blank E3-E12 for unknowns
  • F1 - F12: dilute by 2
  • G1 - G12: dilute by 5

Materials:

  • ~1 mL 1mM fluorescein (try to make it right via Abs)
    • E = 50358/M
    • A = 50358/M * C
    • at 10 µM, A = 0.5038
    • dilute 1 mM 1/100 to make 10 µM, take Abs
  • 5 mL 10 mM NaOH
  • black plate from last time (or new one if old one has no clean wells)

Conversion factors

Abs = 59.7*(mM)-0.341 up to mM=0.03125

FL = 10^6 * mM +173.06 up to mM = 0.008

FL = 2 X 10^6 * mM + 19.624 up to mM = 0.00195

Unknowns

  • Make dilution series from the "1mM" stock.
  • find lowest useful concentration for Abs. Dilute slightly for unknown 1 - must be done with FL. Abs is bad below 0.0005 and meaningless below 5 x 10^-7mM
  • find a concentration too high for fluorescence, but OK for abs, e.g., 0.05.
  • find a concentration too high for either. must be >0.125

2013:

label ~mM Abs FL
P 0.0001 ~0 210
Q 0.015 0.8699 16496
R 0.1 4.955 26780

2012

2012 kdorfman Mon, 08/19/2013 - 17:12

1.1: Fluorescein

1.1: Fluorescein kdorfman Mon, 11/14/2011 - 21:27

Fluorescein Absorbance and Fluorescence

Materials for 1.1

Materials for 1.1 kdorfman Mon, 11/14/2011 - 21:32

Materials

  • 1 black-walled plate per pair
  • non-sterile tips
  • Mats
  • Gloves
  • Serial dilution by 5 for demonstration purposes.
    • First tube saturated
    • Last tube blank.
  • blue flashlights & yellow filters

Computers and Plate Readers

  • Check program Repeatability (Abs 485 nm; layout A1-B12)
  • Wahoo folders must be named Tues01, Tues02, ...Tues12 and Thur01, Thur02 ... Thur12, even though the user names in the Optima program are Tue01 and Thu01, etc.
  • Import program to groups
  • Check network connections (in “my computer” connect the Z drive to Wahoo as kdorfman, kd@hh3)

Reagents for 1.1

Reagents for 1.1 kdorfman Mon, 11/14/2011 - 21:28

10mM NaOH

MW = ~40

10mM = 0.01M = 0.4g/L

Need:
- 25 tubes of 10 mL each = 250 mL NaOH

  • 13 tubes of 2 mL each = 26 mL fluorescein A

  • 13 tubes of 2 mL each = 26 mL fluorescein B

= total of 300 mL NaOH needed


1 mM Fluorescein

in 10 mM NaOH

It fades with time, so check the concentration of the old stocks.

MW = 332

1mM = 0.332g/L = 0.033g/100 mL

A = Ecl

Molar extinction coefficient of fluorescein at 485nm = 50358/mol.cm

so Absorbance 10^-5M = 0.50358

(1/100 of a 1mM solution =10^-5M)

Make A & B slightly different.

(Different enough so that they are different by the t-test. Make one above and one below the “actual” value.)

Be sure to measure a blank. In 2012, the blank was ~0.25, so Abs readings should be ~0.75

1.2: Fluorescein II

1.2: Fluorescein II kdorfman Mon, 11/14/2011 - 21:40

Absorbance & Fluorescence of Fluorescein, part 2

Unknowns

  • One too dilute to measure with abs (e.g., 0.0003mM; A3x10^-7M = 0.015)

  • One too concentrated to measure with Fl (e.g., above 0.01mM)

  • One too concentrated for either, e.g., 0.12 mM

Tell instructors the Abs and Fl of each, w/gain adjusted for the 1 mM solution

Give students:

  • ~6 mL 10mM NaOH

  • ~1 mL 1mM fluorescein. (Make sure Abs is correct)

Make dilution series

Check programs for correct wells.

Get a laptop for the TA to demonstrate stupid Excel tricks.

2012 unknowns

2012 unknowns kdorfman Tue, 09/18/2012 - 17:51
Unknown ~ mM ~Abs Abs blank ~ Fl Fl blank
P 0.25 5.745 0.023 38000 19
Q 0.00024 0.039 0.023 679 19
R 0.0625 4.171 0.023 32000 19

2.1: Counting bacteria

2.1: Counting bacteria tfriedri Thu, 10/13/2011 - 18:39

Counting Bacteria

Question of the day: What concentration has the stock culture?

Materials

  • Clean clear 96 well plate
  • Sterile glass beads
  • Sterile microfuge tubes
  • Ice buckets (fill with ice at beginning of period)
  • 8 LB plates per pair
  • ice cold LB broth
  • ~4 mL E. coli in stasis - ice cold
  • spray bottle of 70% EtOH to clean tables
  • hemocytometer

Program plate reader:

  • Bug_OD
  • A1-A12, B1-B12

Bio-hazard waste bin for

  • multi-well plates
  • agar plates after counting
  • little tubes of E. coli
  • hemocytometers

2012 new thoughts

2012 new thoughts kdorfman Tue, 10/09/2012 - 21:34

Start with ice cold culture in stationary phase, OD = ~1.5

Make a 2-fold dilution series (in microtubes?)

Make a 10-fold dilution series (in microtubes?)

Load 96 well plate

Get OD’s

Keep cells on ice!

Make OD vs dilution curve (combine data from 10-fold and 2-fold dilution series)

Count cells from some well (should have theoretical OD = ~ 10-6).

Too many? Use a more dilute one. Too few? Go up one.

Make agar plate from 8 wells

Calculate OD (from Od vs dilution factor) for the wells used in hemocytometer

Calculate OD for the wells used in the agar plate

Get cells/mL/OD conversion factors by both methods. Compare.

OR: make a table: if OD of first well is __, then use well# __ for the hemocytometer.

Important observations

A stationary phase culture (left at RT for several days) has OD = 2.6

Relationship between dilution and OD is linear through about OD = 1.5

By hemocytometer counts, there are ~5 x 10^8 cells/mL/OD

Cells are countable (19 cells/0.004 µL and 27 cells/0.005 µL) in the hemocytometer at 5 x 10^6 cells/mL, or blank corrected OD = ~0.01 (about where it slips into the noise)

So recommend either

  • to start with well #9 in the 2-fold dilution series, or
  • if they have done the OD's first, use the first well with a blank-corrected OD below 0.03

E coli 2013

E coli 2013 kdorfman Wed, 09/11/2013 - 16:15

Week before lab:

  • streak out control cells on agar plate

  • grow overnight at 37C

  • cover plate and refrigerate

Two days before lab:

  • pick colony, put into enough LB for all students (~250 mL)

  • grow on shaker overnight

Day before lab:

  • put LB in fridge

    • need ~15 mL
    • 2013 - have lots of 25 mL tubes of LB. Use them up
  • check during day for stasis (OD = ~2.6 in previous years; growth seems to stop at OD = ~2, which is still in the linear range)

NOTE: If left too long on shaker, get too many in chains. Check culture first thing in the morning with microscope. OD = 2, still swimming. Put in fridge.

  • refrigerate to stop growth

  • Dilute or spin down and resuspend to OD = ~2.5 (around max linear correlation to conc) with ice cold LB

  • Aliquot ~4 mL/tube

  • 1 tube per pair

Reagents 2012

Reagents 2012 kdorfman Wed, 09/11/2013 - 16:17

Reagents

2.2: Bacterial growth

2.2: Bacterial growth kdorfman Wed, 01/04/2012 - 19:08

Give students 1 column from E. coli growth file

2016 GFP molecular biology

2016 GFP molecular biology kdorfman Mon, 06/13/2016 - 20:36

2017 molecular biology

2017 molecular biology kdorfman Thu, 09/07/2017 - 22:01

GET STUDENT DOOR ACCESS

For Friday 9/8/16:

  • miniprep kit
  • 50% sterile glycerol
  • cryovial

For Monday 9/11/17:

  • streak 9 LB-carb plates from both GFP construct frozen cultures

For class Tuesday 9/12 and 9/14:

  • LB-Carb
    • 12 tables x 25 mL/table = 300 mL
    • 300 mL LB + 300 uL carb
  • alcohol burners
  • toothpicks
  • 5 mL pipets
  • pipet fillers
  • labeled racks in fridge

For class Tuesday & Thursday 9/19 & 21

  • Miniprep kits
  • aliquot miniprep reagents
  • centrifuges

2019 molecular biology

2019 molecular biology kdorfman Wed, 05/29/2019 - 17:49

New plasmid

Addgene pICH47732

MoClo level 1 destination vector pL1F-1

gen bank entry

from Bartlett lab

amp-r

Lac-Z cassette

Test for restriction sites:

per 20 uL reaction:

  • 10 uL midiprep DNA (40 ng/uL)

  • 2 uL 10x NEB cut smart

  • 1 uL enzyme (all from NEB) or water

  • 7 uL water

    • water/control
    • BamH1
    • EcoR1
    • Kpn
  • incubate 1 hr at 37

  • Mix with 4 uL loading dye

  • Run in 1% agarose gel ~1.5 hr (needs a long run - the DNA pieces are long)

  • See attached picture below

Sequence

    1 gtggggccca ctgcatccac cccagtacat taaaaacgtc cgcaatgtgt tattaagttg
   61 tctaagcgtc aatttgttta caccacaata tatcctgcca ccagccagcc aacagctccc
  121 cgaccggcag ctcggcacaa aatcaccact cgatacaggc agcccatcag tcagatcagg
  181 atctcctttg cgacgctcac cgggctggtt gccctcgccg ctgggctggc ggccgtctat
  241 ggccctgcaa acgcgccaga aacgccgtcg aagccgtgtg cgagacaccg cggccgccgg
  301 cgttgtggat acctcgcgga aaacttggcc ctcactgaca gatgaggggc ggacgttgac
  361 acttgagggg ccgactcacc cggcgcggcg ttgacagatg aggggcaggc tcgatttcgg
  421 ccggcgacgt ggagctggcc agcctcgcaa atcggcgaaa acgcctgatt ttacgcgagt
  481 ttcccacaga tgatgtggac aagcctgggg ataagtgccc tgcggtattg acacttgagg
  541 ggcgcgacta ctgacagatg aggggcgcga tccttgacac ttgaggggca gagtgctgac
  601 agatgagggg cgcacctatt gacatttgag gggctgtcca caggcagaaa atccagcatt
  661 tgcaagggtt tccgcccgtt tttcggccac cgctaacctg tcttttaacc tgcttttaaa
  721 ccaatattta taaaccttgt ttttaaccag ggctgcgccc tgtgcgcgtg accgcgcacg
  781 ccgaaggggg gtgccccccc ttctcgaacc ctcccggccc gctaacgcgg gcctcccatc
  841 cccccagggg ctgcgcccct cggccgcgaa cggcctcacc ccaaaaatgg cagcgctggc
  901 caattcgtgc gcggaacccc tatttgttta tttttctaaa tacattcaaa tatgtatccg
  961 ctcatgagac aataaccctg ataaatgctt caataatatt gaaaaaggaa gagtatgagt
 1021 attcaacatt tccgtgtcgc ccttattccc ttttttgcgg cattttgcct tcctgttttt
 1081 gctcacccag aaacgctggt gaaagtaaaa gatgctgaag atcagttggg tgcacgagtg
 1141 ggttacatcg aactggatct caacagcggt aagatccttg agagttttcg ccccgaagaa
 1201 cgttttccaa tgatgagcac ttttaaagtt ctgctatgtg gcgcggtatt atcccgtatt
 1261 gacgccgggc aagagcaact cggtcgccgc atacactatt ctcagaatga cttggttgag
 1321 tactcaccag tcacagaaaa gcatcttacg gatggcatga cagtaagaga attatgcagt
 1381 gctgccataa ccatgagtga taacactgcg gccaacttac ttctgacaac gatcggagga
 1441 ccgaaggagc taaccgcttt tttgcacaac atgggggatc atgtaactcg ccttgatcgt
 1501 tgggaaccgg agctgaatga agccatacca aacgacgagc gtgacaccac gatgcctgta
 1561 gcaatggcaa caacgttgcg caaactatta actggcgaac tacttactct agcttcccgg
 1621 caacaattaa tagactggat ggaggcggat aaagttgcag gaccacttct gcgctcggcc
 1681 cttccggctg gctggtttat tgctgataaa tctggagccg gtgagcgtgg ttctcgcggt
 1741 atcattgcag cactggggcc agatggtaag ccctcccgta tcgtagttat ctacacgacg
 1801 gggagtcagg caactatgga tgaacgaaat agacagatcg ctgagatagg tgcctcactg
 1861 attaagcatt ggtaactgtc agaccaagtt tactcatata tactttagat tgatttaaaa
 1921 cttcattttt aatttaaaag gatctaggtg aagatccttt ttgataatct catgaccaaa
 1981 atcccttaac gtgagttttc gttccactga gcgtcagacc ccgtagaaaa gatcaaagga
 2041 tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg
 2101 ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact
 2161 ggcttcagca gagcgcagat accaaatact gtccttctag tgtagccgta gttaggccac
 2221 cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg
 2281 gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg atagttaccg
 2341 gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag cttggagcga
 2401 acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc cacgcttccc
 2461 gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg agagcgcacg
 2521 agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc
 2581 tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc
 2641 agcaacgcgg cctttttacg gttcctggca gatcctagat gtggcgcaac gatgccggcg
 2701 acaagcagga gcgcaccgac ttcttccgca tcaagtgttt tggctctcag gccgaggccc
 2761 acggcaagta tttgggcaag gggtcgctgg tattcgtgca gggcaagatt cggaatacca
 2821 agtacgagaa ggacggccag acggtctacg ggaccgactt cattgccgat aaggtggatt
 2881 atctggacac caaggcacca ggcgggtcaa atcaggaata agggcacatt gccccggcgt
 2941 gagtcggggc aatcccgcaa ggagggtgaa tgaatcggac gtttgaccgg aaggcataca
 3001 ggcaagaact gatcgacgcg gggttttccg ccgaggatgc cgaaaccatc gcaagccgca
 3061 ccgtcatgcg tgcgccccgc gaaaccttcc agtccgtcgg ctcgatggtc cagcaagcta
 3121 cggccaagat cgagcgcgac agcgtgcaac tggctccccc tgccctgccc gcgccatcgg
 3181 ccgccgtgga gcgttcgcgt cgtcttgaac aggaggcggc aggtttggcg aagtcgatga
 3241 ccatcgacac gcgaggaact atgacgacca agaagcgaaa aaccgccggc gaggacctgg
 3301 caaaacaggt cagcgaggcc aagcaggccg cgttgctgaa acacacgaag cagcagatca
 3361 aggaaatgca gctttccttg ttcgatattg cgccgtggcc ggacacgatg cgagcgatgc
 3421 caaacgacac ggcccgctct gccctgttca ccacgcgcaa caagaaaatc ccgcgcgagg
 3481 cgctgcaaaa caaggtcatt ttccacgtca acaaggacgt gaagatcacc tacaccggcg
 3541 tcgagctgcg ggccgacgat gacgaactgg tgtggcagca ggtgttggag tacgcgaagc
 3601 gcacccctat cggcgagccg atcaccttca cgttctacga gctttgccag gacctgggct
 3661 ggtcgatcaa tggccggtat tacacgaagg ccgaggaatg cctgtcgcgc ctacaggcga
 3721 cggcgatggg cttcacgtcc gaccgcgttg ggcacctgga atcggtgtcg ctgctgcacc
 3781 gcttccgcgt cctggaccgt ggcaagaaaa cgtcccgttg ccaggtcctg atcgacgagg
 3841 aaatcgtcgt gctgtttgct ggcgaccact acacgaaatt catatgggag aagtaccgca
 3901 agctgtcgcc gacggcccga cggatgttcg actatttcag ctcgcaccgg gagccgtacc
 3961 cgctcaagct ggaaaccttc cgcctcatgt gcggatcgga ttccacccgc gtgaagaagt
 4021 ggcgcgagca ggtcggcgaa gcctgcgaag agttgcgagg cagcggcctg gtggaacacg
 4081 cctgggtcaa tgatgacctg gtgcattgca aacgctaggg ccttgtgggg tcagttccgg
 4141 ctgggggttc agcagccagc gcctgatctg gggaaccctg tggttggcat gcacatacaa
 4201 atggacgaac ggataaacct tttcacgccc ttttaaatat ccgattattc taataaacgc
 4261 tcttttctct taggtttacc cgccaatata tcctgtcaaa cactgatagt ttaaaccact
 4321 tcgtgcagaa gacaattgca gcgtgagacc gtcacagctt gtctgtaagc ggatgccggg
 4381 agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg ctggcttaac
 4441 tatgcggcat cagagcagat tgtactgaga gtgcaccata tgcggtgtga aataccgcac
 4501 agatgcgtaa ggagaaaata ccgcatcagg cgccattcgc cattcaggct gcgcaactgt
 4561 tgggaagggc gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa agggggatgt
 4621 gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg
 4681 acggccagtg aattcgagct cggtacccgg ggatcctcta gagtcgacct gcaggcatgc
 4741 aagcttggcg taatcatggt catagctgtt tcctgtgtga aattgttatc cgctcacaat
 4801 tccacacaac atacgagccg gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag
 4861 ctaactcaca ttaattgcgt tgcgctcact gcccgctttc cagtcggcaa acctgtcgtg
 4921 ccagctgcgg tctcactccg gatccgaatt cggcattgtc ttcacaga

3.1 Lac operon I

3.1 Lac operon I kdorfman Wed, 10/12/2011 - 15:35

Lac Operon 1

2011

2011 kdorfman Mon, 09/17/2012 - 17:55

E. coli for 3.1

E. coli for 3.1 kdorfman Wed, 10/12/2011 - 15:44

Streak GFP cells (from -80 freezer) on LB-Kan agar

Grow overnight culture in minimal medium + Kan (50 µg/mL).
(Aliquots in freezer are labeled in 1, 3, 6, 10 mg/mL.)
See here for Kan volumes

Each group needs 4 mL cells. Should prepare to have 8 mL/group = ~100 mL

  • Start 3 5 mL overnight cultures the night before.
  • Shake at 37C
  • Early morning: inoculate culture into minimal medium in flasks, turn off heat.
  • Throughout morning: Check OD's.
  • If OD > 0.8, dilute
  • If OD < 0.8, turn on heat

    OD should be ~ or just > 0.8 when students come for cells.

Students should get all their solutions ready before they come to get cells.

Dispense cells in glass tubes when students are ready.

For incubation with sugars, use the round bottom centrifuge tubes with the two stage caps from room 368. BD Falcon 352059. 14 mL polypropylene 17 x 100 mm, available at the Fisher stockroom. Fisher 14-959-11B.

During lab, spin the cells down in the big Eppendorf in 368. Don't turn on the refrigeration. Use the 6-tube adapters in the swinging buckets.

Media for Lab 3.1

Media for Lab 3.1 kdorfman Wed, 10/12/2011 - 15:50

Note: very small pellets, not too much green, except with IPTG. Dissapointing. Get a better pellet with 6 mL of culture + 4 minute spin (max speed = 500 with swinging bucket rotor). But still no obvious induction with lactose.

minimal medium + Kanamycin (50 µg/mL)
Aliquots in freezer are labeled in 1, 3, 6, 10 mg/mL

Adding Kanamycin to __mL medium

Kan mg/mL 10 25 50 100 250 500 1000 mL medium
1 0.5 1.25 2.5 5 12.5 25 50 uL Kan
3 0.17 0.42 0.83 1.67 4.17 8.33 16.67 uL
6 0.08 0.2 1 0.42 0.83 2.08 4.17 8.33 uL
10 0.05 0.125 0.25 0.5 1.25 2.5 5 uL

Sugar solutions

Ingredient vendor cat # MW mM 10 25 30 50 100 mL
glucose 180.15 500 0.9 2.25 2.7 4.5 9 g
galactose 180.15 500 0.9 2.25 2.7 4.5 9 g
maltose 342.3 500 1.8 4.5 5.4 9 18 g
lactose 342.3 500 1.8 4.5 5.4 9 19 g
IPTG (100mM) 0.4 0.004 0.01 0.012 0.2 0.4 mL

Each group needs

medium mL per group ~mL total
minimal 3 100
lactose 1 50
IPTG 0.75 25
gal 0.5 15
glu 1 30
malt 0.25 10

For Lab 3.2, each group needs enough as if to fill two rows of a plate with 100µL = 2.4 mL

2012

2012 kdorfman Mon, 09/17/2012 - 17:57

First thing, the morning before:

  • Pick a colony
  • Grow in 3 mL LB-Kan

Last thing, the day before: 100 µL culture into 40 mL (each w/ Kan)

  • LB
  • Lac 0.25 M
    • 20 mL LB
    • 20 mL Lac 0.5 M
  • IPTG 0.1mM
    • 20 mL LB
    • 20 mL 0.2 mM IPTG
  • Glu 0.25 M
    • 20 mL LB
    • 20 mL 0.5 M glu
  • Gal 0.25 M
    • 20 mL LB
    • 20 mL 0.5 mL gal
  • Mal 0.25 M
    • 20 mL LB
    • 20 mL 0.5 M mal
  • IPTG 0.1 mM + glu 0.25 M
    • 20 mL 0.2 mM IPTG
    • 20 mL 0.5 M glu
  • IPTG 0.1 mM + mal 0.125 M
    • 20 mL 0.2 mM IPTG
    • 10 mL LB
    • 10 mL 0.5 M mal
  • Lac 0.25 M + glu 0.25 M
    • 20 mL 0.5M lac
    • 20 mL 0.5 M glu
  • Lac 0.25 M + mal 0.125 M
    • 20 mL 0.5M lac
    • 10 mL LB
    • 10 mL 0.5 M mal
  • Gal 0.25 M + glu 0.25 M
    • 20 mL 0.5 M gal
    • 20 mL 0.5 M glu
  • Gal 0.25 M + mal 0.125 M
    • 20 mL 0.5 M gal
    • 10 mL LB
    • 10 mL 0.5 M mal

Morning of:

  • Aliquot ~4 mL each culture into plastic tubes.
  • One set per 4 tables.
  • ? save for next lab in fridge?

Media for Lac I

Media for Lac I kdorfman Mon, 09/17/2012 - 18:10

LB (150 mL)

LB +

  • 0.1mM IPTG (60 mL)

  • 0.5 M lac (60 mL)

  • 0.5 M glu (80 mL)

  • 0.5 M gal (60 mL)

  • 0.5 M mal (40 mL)

Make enough for Lac operon I and II:

150 mL each + 50µg/mL Kan

  • lac = 27 g

  • gal = 13.5 g

  • mal = 27 g

  • IPTG = 0.3 mL 100mM stock

200 mL glu = 18 g

Kan calculation here:

https://wahoo.nsm.umass.edu/content/media-lab-31

2014

2014 kdorfman Fri, 10/03/2014 - 18:42

Mixtures needed to grow 50 mL cultures for qualitative experiment

Need an additional ~90 mL of each sugar for quantitative student experiments the next week.

LB-sugar recipes

medium LB lac IPTG glu gal mal
a 50
b 25 25
c 25 25
d 25 25
e 25 25
f 25 25
g 25 25
h 12.5 25 12.5
i 25 25
j 12.5 25 12.5
k 25 25
l 12.5 25 12.5
Totals 212.5 75 75 100 75 62.5

2015

2015 kdorfman Thu, 10/08/2015 - 18:36

Make enough media for 3.1 (25 mL) and 3.2 (200 mL of LB, 150 Lac, 150 glu, 100 each of the others)

Calculate amount of each medium assuming they will make mixtures in 2 mL tubes. Each group needs ~12 mL. Mostly LB, then lac, then glu

for 3.1:

  • Each pair gets 1 set of 12 tubes, each with E. coli already grown up. LB +

    • nothing
    • lac (0.25 M)
    • IPTG (0.01mM)
    • glu (0.25 M)
    • gal (0.25 M)
    • mal (0.25 M)
    • IPTG + glu
    • IPTG + mal
    • lac + glu
    • lac + mal
    • gal + glu
    • gal + mal
  • Overgrown cultures all are too fluorescent!

  • Can use the same tubes for both lab sections (if students don't throw them out)
  • Night before: grow up GFP E coli from liquid culture in ~25 mL
  • morning of: aliquot cultures into tubes 1mL each.

Question of the day

Question of the day tfriedri Mon, 10/17/2011 - 20:55

Which chemical compounds influence lac operon expression?

Replace "concentrations" with "compound combination"

Replace "concentrations" with "compound combination" tfriedri Mon, 10/17/2011 - 20:59

Replace "concentrations" with "compound combination" in the question why they were chosen. Prevents answers like: To have a final vol. of 1 ml.

Or make it a specific question to be answered in the report. As it is nobody got the idea behind it.

3.2: Lac operon II

3.2: Lac operon II kdorfman Tue, 10/18/2011 - 15:08

Quantitative Analysis of the Kinetics and Extent of Induction

Thursday 10/20/11 and Tuesday 10/25/11

E. coli for 3.2

E. coli for 3.2 kdorfman Tue, 10/18/2011 - 15:18

GFP E. coli grown in LB

Grow cells in LB-Kan 1

Overnight culture

Dilute and monitor in morning; keep cells in active growing phase. Turn off heat in shaker if necessary.

Need ~20 mL total (8x12x2x100uL)

OD of culture should be 0.4 when cells are added to plates. That will put the OD just down into the noise, so there will be a lag time at the beginning of the run.

TA aliquots 100 uL cells to student wells, so the OD in the well will be half of the OD in the culture.

100 µL in 96 wells on 2 plates = ~20 mL of cells

Run at RT to be comparable to growth curves (set thermostat to 25C).

Use Script Mode on the plate reader. Program is called E_coli_glow&grow.

Check layout - make sure all rows used are read!

Fix file names so OD, FL, ps1, ps2 are obvious.

Move all the files into a folder labeled with the lab day as soon as the program is through running - otherwise, the data files for the second lab day are interleaved with those for the first lab day. (Sorting by time created may help you out of this fix, though.)

The 12 minute pause is to make the cycle take 15 minutes. Check that lab manual explains this. Enter the time on the compiled file in 15 minute intervals.


  1. Consider growing cells in LB+glu, then spinning down and resuspending in LB. They are slightly fluorescent in LB. ↩︎

reagents for 3.2

reagents for 3.2 kdorfman Tue, 10/18/2011 - 15:24

2013 - run program for 12 hours. long enough to get past stasis, and show that fluorescence continues to increase.

Give each group of 4 5 mL of each medium

Let them mix in microfuge tubes if they want.

NOTE: plate lid got stuck on PS2 - data completely worthless. Try grinding down the bottom, different lids, tape. Do a dummy run in the morning.

Had to raise up the detector by putting slices of blue ruler under its frame. Also tape the lid to the plate, and the plate to the tray.

LB + Kanamycin (50 µg/mL)
Aliquots in freezer are labeled in 1, 3, 6, 10 mg/mL

If students loaded a whole row with a single solution, they would need 1.2 mL.

antibiotic calculator

Aliquot ~1.5 mL of each medium:

Totals for both days (25 groups)= 37.5 mL

Make 50 mL each
(If there are any left over from the previous year, make ~35 mL, because that is how much can be sterilized in one go with the 35 mL syringe + filter.)


Adding Kanamycin to __mL medium

Kan mg/mL 10 25 35 50 100 250 500 1000 mL medium
1 0.5 1.25 1.75 2.5 5 12.5 25 50 mL Kan
3 0.17 0.42 0.595 0.83 1.67 4.17 8.33 16.67 mL
6 0.08 0.21 0.252 0.42 0.83 2.08 4.17 8.33 mL
10 0.05 0.125 0.175 0.25 0.5 1.25 2.5 5 mL

Sugar solutions

Ingredient vendor cat # MW mM 35 50 100 250 mL
glucose 180.15 500 3.15 4.5 9 22.5 g
galactose 180.15 500 3.15 4.5 9 22.5 g
maltose 342.3 500 6.3 9 18 45 g
lactose* 342.3 500 6.3 9 18 45 g
IPTG (100mM) 0.1 0.035 0.05 0.1 .25 mL

Filter sterilize! Do not autoclave media with sugars!
* lactose takes a long time to go into solution. heat and stir overnight, covered with parafilm.

4: GFP folding

4: GFP folding margaret Wed, 11/02/2011 - 13:37

START UREA THE DAY BEFORE!

Hot blocks: set to 90C


DTT 1M

MW = 154.25.

Frozen 1M stock - take out early, vortex. It looks like it will never go back into solution, but it will.

To make mL 1M DTT
add: g DTT (dry, stored in freezer)


TNG
100 mM Tris, pH. 7.5, 150 mM NaCl, 10% glycerol, 5 mM DTT

students fill 12 wells @ 200 µL = 4800 µL, so aliquot 5 mL/group

Make 150 mL

To make mL TNG
add: mL 1M Tris pH 7.5
add: mL 5M NaCl
add: mL glycerol
add: mL 1M DTT


UREA 9M + 1mM DTT
students need ~ 1537 µL/group. Aliquot 4mL/group

Make 125 mL

1M DTT: 0.125 mL

Urea MW = 60.06
vi = 9mol/L x 0.125L x 60.06g/mol = 67.568g

To make mL Urea-DTT
add: g urea
add: mL H20
add: mL 1M DTT

Stir overnight! Gets very cold! Add heat if necessary

Stir! Takes overnight! Gets very cold!

Do not refrigerate concentrated urea - it precipitates!

NOTE: 100 mL makes only just 25 aliquots of 4 mL!


GFP
Molar extinction coefficient of GFP = 8.33 x 104/M/cm

MW = 27000

A 4mg/mL solution = 1.48 x 10-4M

Stock solution in freezer is 9.6 mg/mL.

Students get 4 mg/mL GFP, then dilute it 10-fold. They need to dispense ~180 µL of the 0.4 mg/mL GFP.

Dilute 500µL 9.6 mg/mL stock with 700 µL TNG to make 1200 µL 4 mg/mL for student use:

Lab manual says to give them each 100 µL, even though they really need ~25 µL.
Make 50 µL aliquots, with extras available.

They make a 10-fold dilution with urea, to denature it. (They need about 200 µL final volume, 20 µL initial volume.)

They also make a 10-fold dilution with TNG for native GFP. (They need ~25 µL final volume, 2.5 µL initial volume.)

5.1: Swimming bacteria

5.1: Swimming bacteria kdorfman Fri, 11/04/2011 - 14:05

Observing Swimming Bacteria

E. coli for 5.1

E. coli for 5.1 kdorfman Fri, 11/04/2011 - 14:08

Strain RP437 - wildtype for chemotaxis

At least 2 days before lab:

Streak all chemotaxis strains on LB agar.

Night before lab

Pick a single colony from the RP437 plate, inoculate into ~5 mL minimal medium + HMLTT; shake at 30C

Morning of lab

Inoculate ~200µL into ~45 mL minimal medium + HMLTT

At class time, OD should be ~0.02

Don't let them reach stationary phase!

Making motility movies

Making motility movies kdorfman Fri, 11/04/2011 - 14:42

To make movies with microscopes in 360:

Frames: 50
Interval: 0.1 sec
exposure: 16.38 msec
pixel type: 8 bit
binning: 4

use x4 list (mark 1) stage position list

shutter open

Materials for 5.1

Materials for 5.1 kdorfman Fri, 11/04/2011 - 14:40

Slides

coverslips

perfusion chambers (Coverwell 622503 from Grace Bio-Labs) - clean with distilled water

Microscopes

lens paper

NOTE: The optics are bad with the plastic coverslip on the perfusion chamber. If you peel the silicone gasket off the plastic coverslip and replace it with a glass coverslip, you can see much better! (See if there are thinner gaskets.)

Double-sided tape! Put 4 strips of double sided tape on a slide, lower a coverslip over them, and voila! chambers for bacteria! Make sure the tape strips are longer than the coverslip is wide, so you can introduce cells or media without mixing them.

Try double-sided tape with a liner so it is easier to cut and handle, e.g. MMM4010 at WBMason. Scotch Double-Sided Mounting Tape, Industrial Strength, 1" x 60", Clear/Red Liner

For phase to work, the condenser must be at maximum height!

Phase rings must be aligned! Telescope in microscope bulb drawer can be used to align rings. Loosen the chrome screws, adjust the ring with the little black wheels, then tighten. Repeat for each ring/objective combination.

Darkfield may work, too, but condenser must be at maximum height as well.

Reagents for 5.1

Reagents for 5.1 kdorfman Fri, 11/04/2011 - 14:49

Minimal Medium + HMLTT

Check stocks in refrigerator before making any solutions!

Plus, for extra-mile experiments:

  • 0.01 M glutamic acid

  • pH 5.06 (adjust with acetic acid)

  • 0.01 M galactose

  • 1mM CoCl2

5.2: Motility mutants

5.2: Motility mutants kdorfman Thu, 11/10/2011 - 15:24

Mutations and Aberrant Signaling

Media for 5.2

Media for 5.2 kdorfman Mon, 11/14/2011 - 17:19

Minimal medium + HMLTT.

Enough to grow overnight cultures and make dilute early log phase cultures of all 7 chemotaxis strains for use during lab.

Swarm Agar

ingredient 750 1000 1500 mL
tryptone 7.5 10 15 g
NaCl 3.75 5 7.5 g
bacto-agar 2.25 3 4.5 g
  • Mix tryptone and NaCl in water first.

  • Bring to final volume.

  • Divide into volumes suitable for the vessel(s) going into the autoclave. (E.g., 750 mL per 1 Liter bottle.)

  • Add correct amount of agar (3 g per L) to each container. Leave stir bar in container!

  • Autoclave 60 min

  • Sit on stir plate, stirring, until handleable

  • Pour 25 mL per plate. Plates do not keep well, so pour them the morning of the day they will be inoculated.

4 plates per group. (= 48 minimum) So make 1500 mL. Really need 55 plates + some tiny petri dishes to demonstrate swarm agar consistency.

Inoculate at 7 pm: 13 WT plates + 7 of each of the other strains.

E. coli for 5.2

E. coli for 5.2 kdorfman Mon, 11/14/2011 - 18:22

Chemotaxis strains

Chemotaxis strains kdorfman Fri, 11/04/2011 - 14:39

for 2014:

Do

  • Che A- (run mutant)
  • Che B- (tumble)
  • tar-
  • ser-
ID (2013) RP__ Genotype Run Tumble 24 hr swarm comments
RP437 437 WT yes yes outer 72mm, inner 62mm sensitive to both
A 1237 cheR- cheB- yes 10 mm adaptation deficient if motile at all (see below)
B (A) 2361 tar- yes yes outer 67mm, inner 58 mm aspartate blind, tumble a lot
C* 4130 cheB- yes 9mm esterase deficient (like 1273)
D (B) 5700 tsr - yes yes 24mm serine blind
E (C) 8611 tsr- tar- tap- trg- yes 8 mm unable to stimulate kinase
F (D) 9353 cheA- yes no 7 mm no response. kinase inactive

*C grows poorly. Start it early, spin down and resuspend to get numbers up.


Odd # groups: WT, A, D, E

Even # groups: WT, B, C, F

Genes
Receptors

  • Tar: aspartate receptor

  • Tsr: serine receptor

  • Trg: ribose/galactose receptor (minor)

  • Tap: peptide receptor (minor)

  • Aer: aerotaxis receptor (minor)

other pathway components

  • CheA: receptor regulated kinase that phosphorylates CheY and CheB. Stimulates activity by forming the receptor--A complex, inhibits activity when attractants bind to receptor-W-A complex.

  • CheW: adaptor protein required to form CheA-receptor complex

  • CheB: Receptor methylesterase. When phosphorylated, removes methyl groups from receptor.

  • CheR: Methyltransferase. Methylates receptors, which stimulates kinase activity. Receptor methylation rate increases when attractants bind.

  • CheY: Response regulator. When phosphorylated, binds to the motor, and promotes CW rotation (increases tumble frequency)

  • CheZ: phosphatase. Inactivates CheY-P.


RP1237
Receptors have four major site of methylation on 4 specific glutamic acids side chains in the cytoplasmic domain portion of the receptor.

For the sake of simplicity lets call them EEEE for glutamic acids (single letter abbreviation E) at sites 1,2,3 & 4.

The students have correctly determined that the EEEE receptor cannot stimulate the kinase (no tumbles), which is the phenotype of the CheR- mutant (the receptor cannot be methylated).

Also, the CheB- mutant is likely to be EmEmEmEm (where Em indicates methyl glutamate), so it is continuously kinase-active (tumbling all the time).

So why does CheR-CheB- tumble?

When receptors are synthesized on the ribosome, two of the four sites are actually glutamine (Q). Thus, the covalent modification state is QEQE in newly-synthesized receptors (primarily the aspartate and serine receptors). In addition to its demethylating activity (Em --> E), CheB can also convert Q --> E. But, without CheB or CheR (CheR-CheB-) the receptors remain QEQE.

It turns out that Q is more like Em than E. So QEQE receptors stimulate enough kinase activity to make them tumble in absence of an attractant stimulus.

When enough attractant is added (aspartate or serine), the cells become smooth swimming (the kinase is inhibited), yet without the adaptation enzyme (CheR & CheB), the cells should stay stimulated until the attractant is removed.


Movies

A: WT
B: run
C: tumble
D: WT
E: run
F: tumble

Growing cells for 5.2

Growing cells for 5.2 kdorfman Mon, 11/14/2011 - 18:23

Cultures for swarm plates

Two days before lab:

Note: C (4130) grows poorly. Start it sooner, in a round bottomed centrifuge tube. Spin down and resuspend so there will be enough cells to inoculate the swarm plate.

Start overnight culture (pick one colony from each Chemotaxis strains , inoculate into ~3 mL Minimal medium + HMLTT.)

Shake at 30C

Day before lab:

First thing in the morning

Check cultures and dilute as necessary. The goal is to have dense cultures by 4 pm.

Late afternoon

  • Inoculate 52 swarm plates at 4 pm. Incubate at RT. (Students come in at 9 am, take measurements, put plates in 30C incubator, then come back at lab time.)

  • Start 3 mL overnight cultures of all 7 strains in Minimal medium + HMLTT. Shake at 30C

  • OR use the same cultures to stab swarm plates as to make usable cultures for motility studies the next day.

Day of lab:

First thing:
Inoculate ~100 µL of each strain into ~25 mL medium (~200 into 50 for wildtype)

During morning and lab:
Check cell concentration, diluting as needed. Do not let cells get to stationary phase!

5.3 class data

5.3 class data kdorfman Tue, 11/26/2013 - 20:06

6.1: Fly dissection

6.1: Fly dissection kdorfman Tue, 11/29/2011 - 19:33

Gene Expression in Drosophila - week 1

Check supplies in the "Drosophila stuff" cupboard under the white board before starting prep.


Fixative

Make fresh each lab day

  • 0.2% glutaraldehyde in Shens

  • 0.05 mL glutaraldehyde in 25 mL Shen's

  • aliquot ~2 mL per group


Stain buffer

ingredient Cf (mM) Stock (M) 5 25 50 mL
NaHPO4 buffer 10 1 0.05 0.25 0.5 mL
K4Fe(II)(CN)6 31 0.005 0.31 1.55 3.1 mL
K3Fe(III)(CN)6 31 0.005 0.31 1.55 3.1 mL
NaCl 150 5 0.15 0.75 1.5 mL
MgCl2 1 1 0.005 0.025 0.05 µL

add a maggot sized pinch per 5 mL

  • aliquot ~2 mL per group

  • can make for both sections at once


Stain

  • pinch of stain in 48 mL stain buffer

  • aliquot 2 mL per group

  • can make for both sections at once


Clearing

1 part stain buffer : 2 parts glycerol


Mounting Medium

ingredient conc Units 100 250 500 1000 mL
gelatin 7 % 7 17.5 35 70 g
glycerol 63 % 63 157.5 315 630 g
  • dissolve gelatine in Shens by boiling
  • Add glycerol
  • Bring to final volume with Shen's
  • Refrigerate

6.2: Fly slide analysis

6.2: Fly slide analysis kdorfman Tue, 11/29/2011 - 20:13

Mounting and Examining the slides

Dissecting scopes (1 per student)

Compound scopes (1 per pair)

As many cameras as we have adaptors

Mounting medium

Hot blocks ~45C

Transfer pipets

slides

small coverslips (18 mm or cut the larger ones with a diamond glass scorer) 12-541A at Fisher

2 straight needles per student

1 scoop needle per pair

scissors to cut green tips (50 µL mounting medium per specimen)

Plate Reader

Plate Reader kdorfman Wed, 11/19/2014 - 15:30

To connect to Wahoo: \wahoo.bbmb.isb.nsm\quantbiol

Passwords: pstar1 and pstar2

kd"at"ISB

Optima Plate Reader

QBoC summer projects

QBoC summer projects kdorfman Tue, 10/18/2011 - 22:25

Chemotaxis strains

Chemotaxis strains kdorfman Tue, 11/22/2011 - 19:01

Test all vials of frozen strains, especially (or only, depending on the time available) 4130. The strain used F11 grew very poorly. I had to grow them up in LB, then spin them down and resuspend in motility medium.

chemotaxis techniques

chemotaxis techniques kdorfman Tue, 11/22/2011 - 19:03

Try creating a slide with minimal agar + aspartate, etc.

Put a drop of hot agar on a slide, smoosh with a coverslip, add cells around the perimeter.

Do the cells accumulate near the agar? Compare blind and non-blind cells.

lac operon induction

lac operon induction kdorfman Tue, 10/18/2011 - 22:27

Try larger volumes of cells - maybe 6 mL in round bottom tubes.

Try in LB again - maybe fluorescence isn't as bad as we thought originally.

GFP

GFP kdorfman Fri, 11/11/2011 - 14:25

GFP purification

GFP purification kdorfman Fri, 11/11/2011 - 14:41

sfGFP purification Reagents:

Purification Procedure

Small-Scale Culture for Screening

  1. Streak BL21 (DE3) containing pET28/sfGFP on plates and grow up overnight at 30 C.
  2. Take single colonies and inoculate 4 test tubes containing 2 mL of LB/KAN. Keep 3 more tubes just LB/KAN as blanks for OD measurements and controls.
  3. Shake at 200 rpm and 37C to mid-log growth phase, indicated by the OD600 nm of 0.6 to 0.7. (Referenced against LB/KAN). This takes approximately 3 hours.

Small-Scale Induction

  1. Split 2 mL cultures into two 1-mL cultures and induce one of the cultures with 1 L of 1 M IPTG. Grow the other 1-mL cultures un-induced for comparison.
  2. After IPTG has been added, incubate for 1 h. Small-Scale Screening
  3. Take 500 uL of the induced and un-induced cultures. Centrifuge the cells in 1.5 mL microcentrifuge tubes for 15 min at 13000 rpm (maximum).
  4. Discard the supernatant and suspend pellets in 20 uL of de-ionized water and 20 uL of gel loading buffer for SDS-PAGE.
  5. Boil for 5 min. and check for induction using SDS-PAGE (12.5% gel) in a side-by-side comparison of induced and un-induced cultures to ensure that sfGFP is produced.

Large Scale Cultures and Purification

Day 1

In the latter part of the day set up a 50 mL overnight culture of GFP in BL21(DE3) to obtain a dense culture

  • Add 50 uL of 1000x KAN to 50 mL LB
  • Inoculate culture medium with GFP BL21(DE3) cultures that produced GFP the best (inoculate with un-induced matched sample)
  • Shake at ~200-275 rpm and 30C

Day 2

  1. Inoculate 0.5 or 1 L LB cultures containing 50 ug/mL LB/KAN with 5 to 15 mL of the overnight culture and grow at 30C with shaking at 200 rpm until the OD600 equals 0.6-0.7. Add IPTG to a final concentration of 1 mM and continue the growth for 3 hrs.
  2. Harvest the cells by centrifugation at 3,000 rpm for 30 min. and discard supernatant.
  3. Resuspend the pellet in Buffer A. The final volume of Buffer A should be 25 mL for a cell paste obtained from a 1 L culture.
  4. Freeze the sample and store overnight at -80 C

Day 3

  1. On the following day freeze/thaw the cells 3 times to break up the cell matrix.
  2. Add lysozyme (10 mg/50 mL) and shake gently for 20-30 min at 25C.
  3. Sonicate the cell slurry at 35% power and 35% duty cycle, on ice with occasional stirring, until the solution turns viscous and then returns to a less viscous consistency (about 15 minutes).
  4. Centrifuge the sample at 10,000 rpm at 4C for 1 h.
  5. Collect the supernatant and centrifuge it at 40,000 rpm at 4C for 1 h in Ti 70 rotor. Save the supernatant for affinity column purification.

Preparation of the Ni-NTA column

Washing steps of column before sample run

  • 15 mL 20% of ethanol.
  • 15 mL distilled water
  • 15 mL freshly prepared 0.1 M NiSO4
  • 15 mL of distilled water
  • 15 mL of Buffer A
    • Load the column with sample and adjust the rate at 30/25 mL sample using peristaltic pump or 1 mL/min in HPLC.
    • Wash the column using 3 bed volumes of Buffer B or until the UV280 signal returns to baseline.
    • Elute histidine tagged protein with Buffer C.
    • After using the column, wash it with 5 to 10 column volumes of 0.05 M EDTA, distilled water and 20 %ethanol respectively (Column regeneration).

Protein Dialysis

  • Transfer the sample eluted from the Ni-NTA column using Buffer C to dialysis tubing with a 10,000 MWCO.
  • Dialyze the sample using about 800 mL of Buffer A 3 times. The first round of dialysis is carried out overnight; the 2nd and 3rd rounds are carried out for 2-3 h periods.
  • Assess purity of sample using SDS–PAGE (12.5% acrylamide gel).
  • Determine concentration by absorbance at 485 nm
    Extinction coefficient = 8.33 x 10^4 M-1cm-1 (ref. 1).
  • Flash Freeze in LN2 and store @ -80C.

Plasmid sequence

Plasmid sequence kdorfman Fri, 11/11/2011 - 15:09

pET 28/sfGFP

The sfGFP expression plasmid is based on the pET28 expression vector with Kanamycin resistance. The host strain is BL21(DE3).

Pe´delacq, Cabantous, Tran, Terwilliger and Waldo (2006) Engineering and characterization of a superfolder green fluorescent protein. Nature Biotech. 24, 79-88.

https://www.ncbi.nlm.nih.gov/pubmed/16369541

pET 28/sfGFP sequence (5975 bp)

The sfGFP coding region is bold (741 bp).

TGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACC GCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCG GCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGA CCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCT TTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCT CGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTA ACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTCAGGTGGCACTTTTCGGGGAAAT GTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAATTAATTCT TAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTT GAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTA TCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTA TCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTCC AGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCAT TCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAA TGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATA CCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATG CTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTG GCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTG TCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATT TAATCGCGGCCTAGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATG TAAGCAGACAGTTTTATTGTTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGAC CCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAA AAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAAC TGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAG AACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATA AGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGG GGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTA TGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAG GAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCT CTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCG GCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATT CTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAG CGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATT TCACACCGCATATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACT CCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGAC GGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAG GTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCTGCGGTAAAGCTCATCAGCGTGGTCGTGAAGCGAT TCACAGATGTCTGCCTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTC TGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTTGGTCACTGATGCCTCCGTGTAAGGGGGATT TCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATGCTCACGATACGGGTTACTGATGATGAA CATGCCCGGTTACTGGAACGTTGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGACCAGAGAAAAA TCACTCAGGGTCAATGCCAGCGCTTCGTTAATACAGATGTAGGTGTTCCACAGGGTAGCCAGCAGCATCC TGCGATGCAGATCCGGAACATAATGGTGCAGGGCGCTGACTTCCGCGTTTCCAGACTTTACGAAACACGG AAACCGAAGACCATTCATGTTGTTGCTCAGGTCGCAGACGTTTTGCAGCAGCAGTCGCTTCACGTTCGCT CGCGTATCGGTGATTCATTCTGCTAACCAGTAAGGCAACCCCGCCAGCCTAGCCGGGTCCTCAACGACAG GAGCACGATCATGCGCACCCGTGGGGCCGCCATGCCGGCGATAATGGCCTGCTTCTCGCCGAAACGTTTG GTGGCGGGACCAGTGACGAAGGCTTGAGCGAGGGCGTGCAAGATTCCGAATACCGCAAGCGACAGGCCGA TCATCGTCGCGCTCCAGCGAAAGCGGTCCTCGCCGAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTAC GAGTTGCATGATAAAGAAGACAGTCATAAGTGCGGCGACGATAGTCATGCCCCGCGCCCACCGGAAGGAG CTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTGAGCTAACTTACAT TAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGG CCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTTTCACCAGTGAGACGGG CAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCC AGCAGGCGAAAATCCTGTTTGATGGTGGTTAACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTCGT ATCCCACTACCGAGATATCCGCACCAACGCGCAGCCCGGACTCGGTAATGGCGCGCATTGCGCCCAGCGC CATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGA AAACCGGACATGGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGAGATATT TATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTAATGGGCCCGCTAACAGCGCGATTTGCTG GTGACCCAATGCGACCAGATGCTCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAATAATACTGTTG ATGGGTGTCTGGTCAGAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGG CATCCTGGTCATCCAGCGGATAGTTAATGATCAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCGC CGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCTGGCACCCAGTTGATCGGCG CGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTGGAGGTGGCAACGCCAATCA GCAACGACTGTTTGCCCGCCAGTTGTTGTGCCACGCGGTTGGGAATGTAATTCAGCTCCGCCATCGCCGC TTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCTGATAA GAGACACCGGCATACTCTGCGACATCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCT CTTCCGGGCGCTATCATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCCGGGATCTCGACGCT CTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGC AAGGAATGGTGCATGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACG CCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGG CGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCGAGATCTC GATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAA TTTTGTTTAACTTTAAGAAGGAGATATACATATGAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCA ATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGaGGAGAGGGTGAAGGTGATG CTACAaACGGAAAACTCACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACT TGTCACTACTCTGACCTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCAcATGAAACGGCATGACTTT TTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAcCTACA AGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTT TAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTtTAACTCACACAATGTATACATCACG GCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACgTTGAAGATGGtTCCGTTC AACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTA CCTGTCGACACAATCTGtCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTT GTAACTGCTGCTGGGATTACACATGGCATGGatGAGCTCTACAAAGGATCCCATCACCATCACCATCACT AACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGC TGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG CTGAAAGGAGGAACTATATCCGGAT

BL21(DE3)

BL21(DE3) kdorfman Tue, 10/23/2018 - 15:38

Info on growth of BL21(DE3):

https://link.springer.com/article/10.1007%2Fs00253-006-0554-8#Sec2

Table 1 The maximum optical density and doubling time (DT) of E. coli BL21 (DE3) aerobic batch cultures in different minimal media supplemented with 0.4% glycerol

Medium DT (min) Max OD600nm
M9 102±9 1.2±0.19
N−C− 78±6 1.6±0.14
LR 66±3 3.1±0.14
M9 + Fe2+ 71±1 2.9±0.13
M9 + PO4 3− 71±2 2.2±0.08

N−C− minimal medium contained 10 mM of NH4Cl.

FeSO4·7H2O (0.01 mM) and KH2PO4 (107 mM) were added to M9 minimal medium to supplement it with iron and additional phosphate, respectively.

LeMaster and Richards minimal medium (LR medium) consisted of a mixture of buffer salts (KH2PO4 24.0 g l-1 and NaOH 1.0 g l-1), and mineral salts [(NH4)2SO4 1.675 g l-1, MgSO4·H2O 0.3 g l1, FeSO4·7H2O 3.0 mg l-1, concentrated H2SO4 10 μl l-1], prepared as 10× and 100× concentrates, respectively, and mixed as buffer salts–mineral salts–water in the ratio 10:1:89 (LeMaster and Richards 1982; Paliy et al. 2003).

Values are shown as arithmetic mean±standard error of the mean (n=3).

Only two replicates were used for N-C- and LR

Protein sequence

Protein sequence kdorfman Fri, 11/11/2011 - 15:10

sfGFP protein sequence (241 amino acids), MW 27748 g/mol

MSKGEELFTGVVPILVELDGDVNGHKFSVRGEGEGDATNGKLTLKFICTTGKLPVPWPTLVTTLTYGVQCFSRYPDHMKRHDFFKSAMPEGYVQERTISFKDDGTYKTRAEVKFEGDTLVNRIELKGIDFKEDGNILGHKLEYNFNSHNVYITADKQKNGIKANFKIRHNVEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSTQSVLSKDPNEKRDHMVLLEFVTAAGITHGMDELYKGSHHHHHHStop

The sequence was translated using the EXPASY proteomic server (http://au.expasy.org/tools/dna.html).

Yeast

Yeast kdorfman Thu, 11/14/2013 - 22:29

Strain Thermo Scientific (now GE Dharmacon)

YSC6273-201920294

Mata YIL015W

http://dharmacon.gelifesciences.com/search/?term=YSC6273-201920294

Store in -80

Growth Protocols http://www.sigmaaldrich.com/technical-documents/protocols/biology/yeast…

Streak on YPD plate. Allow 48 hours at 30C.

Hemocytometers

InCyto C-Chip, DHC-N01-5 Neubauer improved

Fisher 22-600-100 50 for $90.78

Growth medium:

http://mcb.berkeley.edu/labs/koshland/Protocols/Media/yepdmedia1L.html

http://wahoo.cns.umass.edu/content/ypd

Per L:

  • in 900 mL H20. Autoclave

    • 10 g yeast extract
    • 20 g peptone
  • In 100 mL H2O. Filter sterilize

    • 20 g glucose

Mix

Plates

http://mcb.berkeley.edu/labs/koshland/Protocols/Media/yepdplates.html

Per 100 mL:

  • 1 g yeast extract
  • 2 g peptone
  • 2 g agar
  • 90 mL water

autoclave.

  • 10 mL 20% sterile filtered glucose

Ingredients:

http://mcb.berkeley.edu/labs/koshland/Protocols/YEAST/Arrestingyeast.ht…

http://www.zymoresearch.com/yeast/specialty-products/alpha-factor-matin…

http://www.sigmaaldrich.com/catalog/product/sigma/t6901?lang=en&region=…

http://www.sigmaaldrich.com/catalog/product/sigma/h8627?lang=en&region=…

Concentrations

ingredient working conc MW stock
nocodazole 0.015 mg/mL 301 3 µL 33 mM (= 10 mg/mL)
HU 0.2 M 76 Koshand lab 2M in H2O
alpha factor for BAR yeast 3 µM 1684 Koshand lab 1mM in 1N HCl
alpha factor for bar- yeast 15 nM " "

Calculations

  • Nocodazole:

To make 50 mL YPD with 0.015 mg/mL nocodazole
25 (!) 3 µL aliquots 10 mg/mL noc
vi = (0.015 mg/mL * 50 mL)/10 mg/mL = 0.075 mL

1.5 µL 10 mg/mL stock per mL medium

  • Hydroxyurea: (Sigma H8267-1g)

To make 50 mL YPD with 0.2M HU
vi = (0.2M * 50 mL)/2M = 5 mL

100µL 2M stock per mL medium

Buy 1 g, make 6.6 mL 2M stock
MW = 76, so 1 g = 1/76 mol = 0.0132 mol
vol = (1000 mL/2 mol) * 0.0132 mol = 6.6 mL

  • alpha factor

To make 50 mL alpha factor at 3 µM from 1 mM stock
vi = (3 µM * 50 mL)/1000 mL = 0.15 mL

Can buy 0.5 mg
To make 1mM stock from 0.5 mg
0.5 mg* (1 mmol/1684 mg) = 0.000297 mmol
vol = (1000 mL / 1 mmol) * 0.000297 mmol = 0.297 mL 0.1N HCl

3 µL 1mM stock per mL of medium for 3 uM

0.015 uL 1mM stock per mL medium for 15 nM

Arrest protocol:

http://mcb.berkeley.edu/labs/koshland/Protocols/YEAST/Arrestingyeast.ht…

Allow 3 hours in drug to arrest.

morning before class

(An overnight culture may not be dense enough!!)

Start ~5 mL ON culture from plate. shake, no heat

9 am, day of class

10 am

  • Aliquot 5 mL YPD into each of 4 tubes.
  • Control. Do nothing
  • Nocodazole. Add 7.5µL nocodazole stock
  • HU. Add 500 µL stock
  • alpha factor. Add 15 µL stock
  • add enough cells to get slightly cloudy
    • OD at 1 pm should be ~0.2
    • So at 9 am, should be ~0.1
  • incubate at RT in tube roller (from biochemistry)

Just before class

  • Check for concentration and clumpiness

    • if necessary dilute
    • sonicate (borrow sonicator from biochem) if necessary: 20% 30 sec 12:30 pm, just before class
  • Make 6 ~0.7 mL aliquots each culture into microfuge tubes

  • One set of 4 per table.
  • Each pair does all 4; table shares the samples.